CR00025

CRIMIC CR00025

Gene CG1640

CG1640

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AGCGCTGAATCATTCACCTTCGG

Amplicon 5' Amplicon 3'
CTGAGCCTTTCAATTCGCCGCTCTTATAATTGTGAGCCGGACTCTTATACACGCACACACCCTTCATTTCGCTGCTTCTTCTTCTTTCCGCTGTTCTCATGGTGCTAAATTCTTGCGATTAAAGCGCGGTCTGTCTCTTTCCTTTTTTTTGTATTTTGAGTAATTTACTTACTGAGACGCTCTTCTCGTTGCAGAAATAATGAGTCGAATGCTAATTAAACCTGCTGCCGCCACAGTTTCGGCCGCATTGCAGCAGCACCAGCGCCAGCAGCAACAGTACGTTATTCGCCGCTGGAAATCGTTCCTGCACAACAACAGCAACAATGCCAATCGACGTGCGGCGAAATCAACGGCAACAGCAACGGTGACGGCAGCAGCGACGTCGCAGCGCCATGGAACAAGCGGCGATTTCATTCAACCGTTAGACGTCCGCCGGTTAGTTTCGTTCGCTGAAAAAGCCGCATAACAAAAACAATATATTTTAAAACACATTTAAAACACGTTATATATCGAACAAGAAGTGATTGTTGATTGCTGAAGTGAATATCCATCCCCTTCTTTTTTTTTCTCAGTTCCTTTTCAACCAGCCACAAAATGCCGTCGTCGTCGAAAGCGCTCACACTGGATAACATAAATCCCAACTTTATTGCCATGGAATATGCCGTTCGCGGTCCTCTGGTGATTCGTGCTGGGGAAATCGAGAAGGAACTGGAAAAGGTGAGTGTTAGTTAATGCCATGGGAAATTGATCCACAAGTAATCGGGCAAACAAAGCGGCAAAGTGCGACGCCATTAACTAGTGTTTTGCACACACCCCCCTACCCTTCCCTCTATTCAATGGCAATTTAATGGCAATTCAAAGCCCGCATTTTAATATCTAAGCACGCTATGTCTCTATGTATATCTACTTATATACACATGCACGTTTATGTATGTATGTATGTATCAAGTGTGAGGCGCGTCTGTGTTTGTTTTTTGCCGCCCTTTTCATTTTTTTATTCGCGCTTGAATGGAGCGGCCACGCAGCGCTGAATCATTCAC GCAATCGTGGTCACCCCTTTCTCAAGGACACCTGTTGGAAAATACGCCCACGAAATGAAGTAATTTGGATTGATAAGAATGGAAGTGTGATAAGAACCAGCCAGGGGAGTACCAATTCAGCTAGCAATCCAATAAAAAATCTATCGAATGTATAAAGTTTCAACAAACAAACATAGAAAACTTTAGCTTTTGTTTATTCAATGCGATAAGGTTTTGTTTTGCAAAAAACACATTTTTGCAAAAACAATAAGCTTGTCGAATAAAAAAAAAACCAGTTTCCAAACCCATTTCTTATTCCACGAGCATAAAAAGCTTACGAAAGTAAAATGCCATATGTTTAATTTCAGTTTTGAGCGAAAAATGTTTACCAAAGAGCACAAAGTTGATCAAAACAATTGTTTGTTTTTTATTACACATCAAGAATTTAGAGTAGTGTTTGAACCACTTGAACTAAACCCATTAAAATTTGCCAAAAATAGAGCTCGGAATTTTATTTACTTCAACTAAACACAAACAATTTTTGGGCAACAATAAAGCTATCAGAAGTAATCCAAAAGTTCAGATAAGACTTGAAATTGTAATCAGACCGCTATAAAAATATCGAGACTTATCTAAAACGGAATATATATCTTTATAAGTGAACTTTGGGCTAAGGGGAAATTACACTTTTTGGGTTAGAGCAAACAACAAGTCAATAAACTAATTAATTTAAGTACTGCTCGGCATGTGAATGATTTTTCCACAGGCAGTTGGCCCAAATTAACCGGTTTTCTCATCTAAAAAAAAAAAACAAAAAAAACGGCGTTTCTTCGCCGTTTTCCATAACGAGTCATGCTCTTAATTGCCAGTTAATGTTTGTAATTATTCTAAATTGTGCTTCTTGGATCAATTAAATAAAGTATTTAGATGAAGAGCGAACGACGCGATGCGATGCGGGTTCACTGAACGACCTT


Search Again