CR00024

CRIMIC CR00024

Gene LamC

CG10119

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 short band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GGGGTTTCGCAGGGGGGACGGGG

Amplicon 5' Amplicon 3'
GCAGCCTTGAGGTTCTGGATCTCATTGTCGTACAGCAGCTCGATCTCCTCGCGATTGATGCGCATTTGACCCTCGTACTGATCACGCAGTTCCTGGAGCGATTGCTGCAGCTTGGCCTCGTATTGACGCGACAGTCGGCCATCGATCTCGCTGATCTCGATCTGGCGACGGGATCGGGTCTCGGTGAGCTCCTGGGTGTGCACCTGATCCTTGAAGGCCAGCTCCTCGCGCAGGCTCTGGTTCTGGTTCTCCAGATCGACGCGGGCCAGCGTCTCCGCCTCCAGCTGCTTGCGAAGATCATCCAGTTGGCGGCGCAGGCGTTCGTTCTCCAGAGCGAGCTCCTTGGCCTGATCCTCGAACTTCTTGCGATCGGCCAACGATTGGTTGTACTTGCCATTCACCTCGTTGTAGCGGTTCTCATACAGGCGGGCATTGTTCTCTGCCACGGTAGCCTCCTTCGTCTTTTTGTCGAGTCTTAAATTTAAAATGGATTTGGTTTAAAAATTAATAATCTTTTATAACAAAGAACTTTTTAATTTAATAATTAATCAGCCTATTTGCCTGAGTAATCCCTTATCGAAATTTAGGCGGTTCATAGGAGCAATTGTTTTTTTTGCTTTTATCTACATGTGCTCATTGAATGACGTCACTTATCTATATAATTATAACTGAGTCACATTGCGACTCACATTTGTTTGCGAAAGCTAAACCGCTCTCTTTATATCGCTTATGTATTATTCATTTCATTTATTTAAATGCTATAGTCGCTTGGAAACTCGTTCATCGATCCTCCTCCATAGAAGAATCAAATACTCAAACATTTCGAGGTTTTTGTTTGCCTTGGGAGAAGTCGTCACATGCCATTAGCATAAAGTAGCCCGGCTATTTCTGACCAGTTCACCCCG CCCCTGTGATTTATGAGCGCCTTTTATTTTTTGTATTTGAAATTCTATTTAGGCAAAAACAAACTCGCTATAAAAAATAGCTACGAAAATTCCACAAATAATCCCTGCATATTTTCGGATATCAATTTTGGTTGTCAATCGGCGACTCGCGTGGTCGGCACGTTTTAAATTATTCTCTATAACAAATCCAATAATTTCAACTATGAAATAATTGACTTTGCATGTCATGCGTTCAATGAAAACGTAATTAAAATTATATATATAGTTTGGCGCCTTTTACGGCGATTGTGTTGACCATTTTTGAAAGTTTATTTTCATGGATTGAAAATCTTCTATTCTGTTTTATCGATTTTCTTTCGGTTTTTGCTGTTGCAACGAGAAAATGTAAACAGTTTTCGTAGCTAATCAAGAAAAGTTGTGTAAAAATGGGGAAATATAAAAACAAAATAGATTCAAGGTTGTTTTGTTTGCGTTCTAGATTTTCATAAATTTCCCCCTTTTTTGTGCGTTTTGTGTGAGCGTGTTAAAGTTCCATTTTTCCTCCCCAATTCCTTCCGCTGACCTAATTCGCTTGTACATATGTATGCTATTGTCACCAAAGAATAAATATGAAAATATATTTGGCTTTCTAAATTCTTCAAAAAAAAATTTAAAATAATTAAGCACAGCCAGCATTCACAAATGAAAATAATTTAAGCAATATGGACACTCAACAAAAGATAAATCTTTTATCACAAGTTCCATAATTCTGCTGCAATCTTATCGTATCTAATCGTAATCATCATAAACAATTTCCTTGGTTATTCCGGTCCGTTGCTCAACGTATAAGCCACACCTTAAGTAGCCGAAAAATCAAGTTTACCCAACATTTAGGCACCCGCCTTTTAGCCAAACTCTTAACTTCGTTAACGCATTGCAAAACGCACAAACAACAAATTGTGGCTATTATGAATTGAAAAAGCTTTGGGCCTCATCGCGCAGTAAATACCAAAAATAAATATGATAACGCAAACGACGCGAAACGGAAATC


Search Again