CR00023

CRIMIC CR00023

Gene ATPCL

CG8322

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78867

Images

Construct Sequences

sgRNA sequence
CGGCGCGTCAGTAAAAAAGCCGG

Amplicon 5' Amplicon 3'
TAAAGTTCGCAATGCCCCCTCCGGTAATCAGCACTTTGCCATCGGGATGCTTTGGCGAGGAGGTCATCAGGTTGAGAATCGTCTTTGCGTACTCGTACGTCTGCTGTTCCGATGGAGCCCCACTGTATTCGCCATAATTGGCCAGCTCGGAGGCTCCACCCAAATCGCAGATGGTGTCCGAGTAAATGACACTGGCGCCACCGCCCGCCACCATCGTCCAGATACGACCATTACGATTAAGGATCGTCAGCTTCAGCGAAGCTCCACTCTTGGCGTCCAAGTCGGCGATGTAGGCCTCCTCGGGATATGCATCTCGACCAAACGGAGGTGGATAGTCAATCTCGCCCCATTTGGGACGGCAGATGAAATCAGCTGTCGAATCCAACTTGGCCGCCAAATCCAAGATGTACAAATTGTCGGCTGTCACCACCAGAGGGTTAATCTCCAGATATGTGAAATACAGGTCTACATAGGTCGTGTACAAGGCGCTGACAAACTTGGCAATGCGCTCCTTGGTGCCCGCGTCCTTGACCTCCTTCAACAGCTTGCTCTTCACGTCGGCTAACGACAGAGAAGAGTTCACAGGTACGTCCAACTTCACGGCCTTAGCATCCACATCGCCAATATCCACGCCACCCTGGTGGTAGAACAGAATGGTGTCTGCGGCGCGGTGCGAGTAGATGCACACGTACATCTCCTCAGCCTTATGGATTAGATACAATGGTGTTAAGTATACATACACATAATAAACAATTTGATAACTCACATCGGTGTGGGGCACAAAAGGTTCGATGATAAAGTTCCTGAGCTTTCCCACGGCATTTCCGATCTTCTGGTCCTTGTTGAGGCGCTCGCCAATCCACTGCTTCACCTGCTCAAAGTTCTTCTTGACGCCAATTAGTCCCAGCTTTCCACGGCGCTTGATAAGTTGATCGGGCTTGCACACCAGCGGCTGCAACAAAGGAAAGGACGGGGCTAATTAAATGTATGCTAAATATAAATGAAATAAGCGACAAATCGTTGAACTTGTGCCTTCTGATCTCGGCGCGTCAGTAAAA CGGTTCCAACGATCAGCATCTGTCGAAAAGATCAGCCGATAACATCAGGGGTCGTTCCCGCGTCATTGCCAATGACAATGCCAGTGCTCGTACCCTTACCCGAACTTGTACTTGTGCCCACACAAAAACACATCTCATATGCTTATTAGAAGATCGTACGAGTGTAAATTGAGCAAACAGTCCGACTACGAAATATCATCCGAGATGTCCGTCAGGCGATTCACTTTGTCGTGTAATTAAAGCCGAAAGAACTCCCATTATGCTCACTAAATTTCGGATCTATCTTAATTGCATATAAAATTACGAGATCAAAATATTAAACTAATAGCTCTAAGTGAAACTATTTAAAGGGAGTTGTATTGTGTTTGATTGTTTGCTTCTCCCCCTTCAGTGGGGTAAACATCATTATCAGTAACGTAATAAAAGTATTATGCACTTCAAACGAAAACGTGACAACAAGACAATAAGTCTATTAAATCAGAAAGTTAATACCTTCTATCTGCATGTCATAAATTAAAACACCTTCCTGATAATCAGAGTTTCACAATCCTGCCTTTAGATTACTAAGACTAAGTATAGGGACGCTCCCTCTAGAGTCAACAAACAACTTATAGATAAGTTTTAACTGATCACATTTCAATAGAATATATTATTTTGCGAAAATTGTTTGAAAGATAGTAGAGTAGTTCCCTGAATCCCCCACTCGACTCAGCGACACTTCGCCACTTTAAAATCTCCGGCATATTTGAATTGAAATTATTCTTTAGAAATTCAGGCGGCGCAACAATGCTAGGTAAGGTCAATAAATTGAGACGCTCCAAAATCAACAAATAACTTGATGATAAGATTTCGAACATATGGATTTCGGTGATAAAGGTTTTCTAAAACAAACACGGAACATGTTAGCTTCCCCTTATTTCCCACTCAACCGTTATAAGTGCTCAAGATAAGTACTTGGCTACAGCCAAACTTTCCACTATCGATCGGAAGGTCAATCAGAGATAGCTGCGTGATCGTGAATCCCAATCTCCACGCACGCTTATCGTGTTCGCAAATGAGGTGAGCCT


Search Again