CR00019

CRIMIC CR00019

Gene KrT95D

CG5405

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ACAGGTGTAAAATTAGCCTGCGG

Amplicon 5' Amplicon 3'
CGCCCACAAACTTAACGCAACGCAACGCATTAGAAAGCCAAACAAAATTGATAGAACAAAAGTCGTTTAGTCAAACTCCAGTTAATAAGCACATCAATAAAAATGCAAAATCAAATCCGCCCGCATTTAAAATATATCCGCCCCGTACTCACCAGCTGTTCCGGTTCCGGGTCCAAGGCCACCGCCCACCAATTGGCTCAGATCTCCGCCGTTTCCGGTGATGTTGTCGTGCAACATAATCCGCGAGTTGGTGAAAAAGGGACGCAGCGATGGCTTCGGCGTGGAGCCCACCGATATGCTGTCCATGTCCGGTCCGGAGTCGTCGCCCTCGCAACAGGACAGCGACTCCAGCTCCTGGAAGAGCGCATCCAGGTCGCGTTCTCCGCGCAGCGCCGCCGTGCCTCGATGACCGGACTCTCCCTCCAGCTCCTCGCTCACCTTGAACCGCTTCAAAAGTGCCACGATCTTTTGCTTGAAATTTCGCTGCTGCAGCGAGATCGTCTAAAAGGAGGAAAGACCATAAAAATTATTATTAATATTTGCTTTTATTGCTTCAATTTTGTAACTATTAAGGGAAAGGGCTAAAAATATTAAACTGCACCAGTAGTTGTCCACTAGAAGCTACAAGATCTTGATCATAAGGAAACAAGATCTTTATATTAAGTTGAAAATATTGTTTTCCCTGCTCTTGCCTTTCCTCATTAATACCCCTTAATTGCCGCTGGATCAATCTAGAGTTGCTTATGGGTCATTAAACGAAATCTCAAGGACTGCGACAGCGTTGACGACTTGTGGGGAGCTGTTAAAATTTATGCATCGTTCTTTTTTAATTGCCCAGCGCTCATCGGTTTCTTTTTGTTTGTTTGTTTTATTTTTTAGGTTTTTTTTTTGTGCTACGGCCTGTCATTAGTCGACTTTTTGTCTACGCCAGCCATTCAAAATGATCCTGCGATAAAAAGCCAGCC TACACCTGTGCTACGGATGTTGGCCAGGTGCGTAGATAAAAAGGGGCGCAGGGAGGCAATGGGCGGGCACCAGGACGAGGCAAAAGTCCATAATTGGCCCAAACGGCTGAGCCGAGTGAGTCAAAGCCAAACGCTGTTTAAATATTTAAGCGGCAGCTTAAGAAAATTGTCTTTGTTGTGATTAGTACGAATGCTTTTAAGGGGAAAAAGGCATAAATAAAGCATGGAATTTCTAAATATGCTGTTCGCTTTGAAAAGAAAGTGGGGAAAATAATCCCATTTAATAATCCTTTTTCGTAGTACAAATCCCCCTTTATATCTAGTCCAACTTGGATATATTCTTATGCGGAAATCCACGACCCCGATATATAGCCCTGAGATATAGCCATAGATTCGAAAGTATGCCACCGGGCGAATCTAAGCAAATTGAGTCGAGTGAGCGACACGCCAAGGCCGCCGCCCCAACAATTGTCAACTATTTGCCACAGAAATTCTTGGCCACCCCGTTTGGGGCATGCTTTTCCCCGAACTTAAGTATCTGTGCAAATGTATGTATATGCACTCTTTTTCTTCTATACTATGGGGATACATATTTGATACATATTTCATTTGATTTGGCCGCCGGGTTGGTGGTAGTGGGTCTTTGTTTTGGGTCGGCTTTTTGTATCTTGTATCTGTGCCTGCGGATCTGGGTTAGCAGCAAGGAACTGACAATATTTCGCAATTGGCAAATGCCTTAGCAAGAATGAGGAGGTAGCAACAAGGTACTAACAATGTTAGACAAGGCTAAGCACAGTTTCGATGAC


Search Again