CR00017

CRIMIC CR00017

Gene CycA

CG5940

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78866

Images

Construct Sequences

sgRNA sequence
TCTAGGTTAGTTAAGGTTCTAGG

Amplicon 5' Amplicon 3'
TGAACCACTTCCAGGAACCGCTGGCGATCGTTGCGCGGCGGAAGCTCCTTGACTCTTCCAGTTGGCGAGACTCCCGTTTCAGTGCCCACGCTGATATCACTGGACTGTATGACACCGAGAATGGAGCGGTCCACGGACATGGGGGACTGAACATCCGTCACGGACATGGGTGTTGAATCCAGATCGTAGTCTACCAGCTCCTTCTGCCCAGCACCGCTGAATGGAGTGAAAAAAAAAACAAACAAAAGTTTGTTTGCGGCTTACCAAGTGACAGATGGAAACTTACAATTTCACGTCATGGTTCTCTTTGTCGACTAGGGAGGCCAGGGATTTGCCGGATGGCGCAACCTGGGTATCGTTGTTGTCCTCATACACGGAGAAGGTCTTGAATTGCTCCACCACGGGCACCACATTCGATTTCTTGGCGCCGTACTCCACATTCTCATCAACATTAAGATTTCTGACGTCACGGAAGACCTGCTGGAAGGAACAGAAGACGAAGAAGACAAATTCAACAATATGGTCAACTTACTATATTAGGTAATAATTTTATATTAGGTAATATTGCAGTGGGATTATAAAAGTAAAAACACAAAGATAATTCCTTTTACATATGCATCCTTAATATAGTAAGCAAAAAAGAAATAAAATGATTATCCCCCCCCATAAATCGATCCAACTTTAAGTTGCGCGCCTTTCCCTGGCTTCCCGTATTGCTCGTGTGTGTGTGTATGTGTGCACCTATACGCATGTGTGCGTTGCATGTCGCAATTGCTTTTGCCCTCCTTGCTTCGCTTTGTTGTTGCAAATCATCAAAAAGGCGCGTAATTGCAAGG GGTTAGGCGCAAGTAAGTGCATTGGTCGTTCTAAGAAGAGAGTAACGTAAGATGGAGAAGTGAAAAGGATGGGATGGTAGGGGAGAGGTAAGGGAGAGAAAACCACCACCACCACTAGGAGATCTCACACATGCGCACGGTCGCAGTGGTGTGACGATCCCACCACCATAAAAATATAAAAAGGCAGCTGCATTGGAATTAGGCACTGGATGTACGGGAAATCGGCAACGGTACTTACAACTTTCCCGGCCGGACGCGGCACATTGTTGTTGCCATTGAGCACGGCGAAATTGGCCCGCGGCGCAAGCGCATTTTTCTCCGCTTTTCCCCCAATTACGGCCAGCGGCTGCTTGGTGTTCTTCACTCCGGCCGGAATCTTAATGCCCGGATTCTCCTTGTTGCTCATGTCTTGGTGGATCTGGAAACTGGCCATGGTGCGCTCTTTCCTACTCCTTTTTTCGCCTTGTAAAATGGAGTCCGATTATGCTCTGCTCTTCCCTTCCTTCTCTCTTTCTCTTAGCGTCGTTGCCTTCTTGCTGTTGTTGTTACTGCTGCTGCCGTTGTTGTTGTTTTGTGCTGCTTTCTTATGCTCGACGCTCACACCGATACGCACACATTCACAGGCTCATATGCTCAACGAAGACGCAGACATGTGTACATTAGGCGCAGGCAAATTTTATCATCGACAAATTGACGCTTGAATTACACGCACACACACAGTTTTGTACAGAATTCATTTGACTTTCAATTTCGTACGGAAGTTTGTGTCACGGCAGCGTTGGAATTAGTTTCCTTGTTTGGCTACGCTCGCACGGACTTAGCTAATATTAAGTATTTTACAAACTCCGTACTTGTTCAGCGGTTCGTGGTTTAAAAGCAATTGCTGGCTTCTTTTGATTTTTTCCCGGTCAACACGTCGTAAATGTTAGAGATGACACTGTCCAGCTATCGATAGGTCGTGGCGTCTATCGACATTTGCCGACAGTGTG


Search Again