CR00012

CRIMIC CR00012

Gene DAT

CG8380

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK OK78865

Images

Construct Sequences

sgRNA sequence
AAACCGTCTAAACTGAAGTCGGG

Amplicon 5' Amplicon 3'
AGCACCACGGCATATCCAATTCCTGTAAGTTAAAGTGTCTTATCCATGAAGTTCTTGTGATTAATTAGTTAGTAGTTAGTAATTACCTTTGAAGAGGGGCACCAAGCGACCCCAGCAGGTTATGGCACCCTTACGATTGTGCTGACCCAGGGCCAATTCCATATAGAACAGAGGAATGCCACCGACCACCAACATAATGCCGTAGGGCACAAGAAAAGCGCCTAAAATTTCACATATTTTTAAATTAAATCTAGTCTAAGAGAACATACGGATTCAATAAAATTTGATTATATTTCAATGAACTGGAAGCTACGATTCCAAATCACAATCGTAGATATTCTCCGCATTACATCCGGTAATTTTTAACCAACTTATTTTCGAGCTGTAGAAACAATCAATATGTTTTCTATGATAATGATTGCATCATAACCATCACATATTGAGACTGACCCGTGTCACAATCTGTGCATTGTTCGCGCTGCCCCCTCATCGACAAACATAATTACACACACAGTTTCTATATAGACACACTCGACCTTTATGTATATGTTCGATGGCACACAAAATCAAATTGTTTTACAAGTGCCACTCTAAGGACATTTTAAAAACATTAACAGCAGCAGCAAGCTGGCGGGTGAGAGGCGGAATATGCGGGGAAAAACCCAACTCGGCTGTCTCCTGCAGTCATCGCCGTCATCTCCGTCACCTCCGGAAAAGCAGCCGAGCCAAAGTTACACGCCCCTTTTGGGCCAGACAATTGGTTAGAGTGCCATCGATACTTTGTCGAGTGGCAGGGGATGATGTTCTATGATTTGATTATGTCTATTAGCAGGCAAAGTGGCCGACGACAAAGTCGTCTAGGGCCAAAACCCACATACACCCAACTGTATGCAAGGGCGTTCGGTGCAAAGTATATCTACAAAGGGTCTGCCAGCTACGGTGCTTCCTTCTGT CATCCATGACGCTCGTCTCTGTTGTTGAAGCCATAATTTCCGTTGCTTCAAGTGCATTTCCACCATTTTCCAGCAGCTCGTCGGAGACACTGTGGAAATATGTGCCTCTAATTCGATTCCCATCCCGTAATTCGGTCAAAACTTGTCCAATTTTAAACGGCCAAGTGTTGGTTATTGCTTGACTAGCAAATTGATATTCTATTGAATTATTGAAAGTTATGCCTACTTAAATGCTTGTGAATAACTTTTTACATGTATTTGTGTAGGACTATTCTGGTTTAAGCTGAGGTGCAAAGTCTCACCATTAAGTCCTTCAGTTCCAAATAGAAATCTAAACTTTTAGACAAATTTAAGAATAAAGAATATAATTTATTGAAATACATAGTTAACCCAAGTACAATCAAGTGCGTATGCGCGATCTTAGTTTGAAAAAAAGCCAGGCAGCTCCTTGAGTTTTAGCCCTAATCCAGAACAATGTGGATGGCACAGCCTGTTGCTGCCACCAAAGCTTCCACTTCCGAGTTGCAGGCAGCAGGAAAATGGGAAACAGAATAAATAATACCGACTAAGCTGTGGTAATAATCGCAACCTGAGCGAGTTGCTGCCCCTGGCAACGGACATAAAATGGAACTTAAGCTGAAGATGGAGCTGGAACCACTGATTGAACGCAATGAAGCGTATAAATATAACAATTTATTATTATGATTTTAAAGCAGCAGCAGCAGCAGCGACCGGGGGTTAGCAGGAGGAAAAAAAGAAAACTCATAAAATAGTAATAACTATATCGAAGGCCCTGTGTGCCACATCCATTCACGACGCATCAGCGGGAAAGTGCCGCAATCAGAGGGAAAATGGGGAGGTGG


Search Again