CR00011

CRIMIC CR00011

Gene Eph

CG1511

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CGAAGAGTTCTGGAAGTCGTTGG

Amplicon 5' Amplicon 3'
ATAGCAGCGTCGGAAAATGCAGGCTCATATGTGTATACGCTTCCTTGTATATATGGATATGCACATATGCCAGTGAATACCGAACAGGAACAGATCCTTCCAAATTATTTATACATTAATCACATTCATGCTTATACAAAGTGCATTAAAGCTAATCAATTTATTTTTTAGTCTTGGATTTTAAACTGGACCCACAAACACAAATAATGCTATTGACATTGGTAAATCCGCATCAGAGTGCGTACAACCCAAATCAAAAATAAAACTGTTCGAAAACGATCCCAACAAAATGAAAATGGTTGGGTGCCACCCAAATGACAAAAAGGTGAAATATGATGGTATTAAAAGTAAAACTTCTTCCGTAACCATTCTAACTTCCGTACTAAATGATGCTATAAGCGCCCTCAAGTCTGCGTTTTACAAAAATCAAGCTCCAATTAGCGAGCAAAACAGATCTCAAATTGTTTCGAGAATGTCATTATTAAGGACAATACTGCTTATTATAATTTCAATTCACTTTAAATTGGCACATGCAGATCAGGGTACGTACTGCTTAACAATATTAAGACTTAACAGTAAATGATATCTTTTTAATGCTCACGAATATCTGCAGTTGTTCTATTGGATACAACTCGAGAAGCTACATTAGAGTGGACCAGGTATCCATATGGACCTCAAGCCCAAACACCAGGGGTACGCATTATATGTTATTGTTGCTCTTATTTTCAATTTTTATTTAAAAAACAAACGTTTGTTTGTAGTTAAACTTACGTCGACAATAATAAGATAGTAGTAATAAGATATTTATATTCAATTTATTCTATGTCAATTCGATTGTGTACAAATTCTTAAAGATTTTATATAGATTTCTTTATATGTGCTCTTTTTTCTAATTGAAAATCATTTAATTTTGAACGTTTTTAATATGTAAATATGCTTATGCTGCTGCGACTGCCAACGACTTCCAGAACT CTTCGCTTGCCGCTCAAAAGAACCTTTGTCTTCGACTTTTAATTTTCTCAGAAGCAGAATCAAATTCATGTGAAATGAACTTACCACAGTTTTTTAAACGCTGATATAATCATGTGTTTTTATTTGGTATACACAACATTTGGAATAATGTTTACTTTGATCCGAAGCAGATGACTAACATTCTTCAGCTGCCATAGAAACGTTTGGGAAATTTATTTAAAACATTTGAAAAGAATTCATCGTTTCGTCGTTTCTAATCATAAAATGTCTTTTTCAGTATAACCAAAGACACTAGAATAACAAGATGCGTAACGGCCATACATTGGTTTGGCACTATGCAGCCACTTTTTTAGTGACGGCCAAAATTGCTCTCTTTCCGCTCGCTCCGGCTGAGAGCGTAAGAAATCTAAAAATAGAATTTGCTTGCTTGTGTGAGTGGAAACAAGAGACGAGAACGCGTATATGATTTTCGGGCCGAAATAAATTCTGATCGACGAAAAGAATTTACATTGTACATATTAGGGTAGTTTTTTGCCAATTTCGTAGCAATATGATAAAATAAGATAATTTTTAAAAATTCGCTCTGACTATTATAATTTTAAAGCTTTTTAAATTTGTTTGTTAAAATCGCCGCTCGAATTAGCTACCGTTTACACATTTATATTTATGTTTAATTCTAATTTGTCTTTCATCTGCCAATCTTTTAAAAGCGAAATATTTTTTTAAACACTTTTAATGTTAATGTTACATCATATTAAGTCAAATGACTTAATAAATATACTAAATAATTAAAGGAAGTACAATAGAAATTATTATAACTACTGTAATTTCATAAATTTCATAAAAATATGATAACTGTTTATTGCAAAAGTCATATCAAAGACACAAGCACTCAACAGTTATTGCCTTATTAATTTTTCAAGATGAATACTCTAATGACAAATATTCTTATATAAAGTCATTTTTGAAATTTATTTTTGTGATATGTACATAGATTTGGCTATTTCTAATCTATTTTCAAATAATAATAACGTTAAGGCAATGCAAAACAAGAATCGCATGGTGCC


Search Again