CR00002

CRIMIC CR00002

Gene CG13887

CG13887

Information

Donor HA-L PCR HA-R PCR Stock number
pM14 short band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GTGGTGGCTTCTGTTTATCGTGG

Amplicon 5' Amplicon 3'
CATTTCTGCTTACAGGCGGCAGTCGAAAAAAGCGAAAATCCAAGAAGCGAAAATCGAACGAAAAAGGGAATTAATAAAACATTAAAAATGAGTTTGGTGTGGACTTTGATCGCCGGATTTCTCTATGCGGAAATCGCACTGGTCCTTCTGCTGGTGCTGCCGGTGCTCACTCCTTACCGCTGGAACCGGTTCTTCAAGTCCAAATTCCTATCGATGTTGGGACAACAGGCGCACATATATTTCCTGCTGATCATGGGAATTCTGGTCATTTTCCTCCTGGAGGCCATTCGCGAGATGCGCAAGTACTCCGGCTTGCAGCAGTCTAACGAGGTCCACTTGAACGTGGAGATGCAGCACAGCATGAAGCTGTTCCGTGCCCAGCGGAACTTCTACATCTCTGGATTCGCCATTTTCCTTGCCCTGGTCATCCGGCGACTGGTAAACTTGATCTGCACCCAGGCCAATCTCATGGCCCAGAGCGAGGCTTCCTTCAAGCAGGCACAGAGCGCCACTGCAGCCGCACGTTCCTTGCTGGAGAACAAGAACACCGAGAAGGCCAAGGAAGCCGGCGAGGATACCACTCTCATCGAGGTGAGTCCACGTCCCAAACCCCTGCATCCGATCCCCAGGAATGGCATGTCTAGAGAGCTAACACCTAAGACTTTGGAGTTCAATTGGCTACTACCAGCTGTAAAGATATGGCAATGCATATAGAAGGTGTGGTCAAAATATGGCGAGATAATGTCTTTAGCCGACTAAATCTATAAAATCTATACTTCATTCCACTTTCTGGTACATTTTCTCAATTGGTTTTGAATATAAGATACGAAAAGGCTTTAAATGTAGTCTATTAACGATATAGAACTTTAAATACCAGTATATATCATGATTAAAATCTTAAACGTAAACTTAAATCAGTTTGAAGACCGAGTGAATTTGTCATAGGCTTAGTGCTTTTGTTTTGACCGCAGCTAAACGTTTTGAAACCACACCCAAACACATATGTTGGGCCACGA AAACAGAAGCCACCACTCGAAAGTTTAAACCTCTTGTTAACTCTTTAAACAGCTGTCAAGACTGCGGAGACGTGTGCAAGGACTCACCGCCCGAGTGTCCTAAGTATCCCCACCTAGAGCACCCACCTTATATCCATTCCCAAACACCCAAAACGAACAAAAATCCAATCGAAACTCAAACGAAATCCGAATTTTGCAGCTCAACAAGCTGCGCGAGCGCGTCCAGGAGCTAACCTCCGACTTGAATCGCGAAAAGAAGGACAAGGAGGCGGTTAAGTCGCAGGCGGAGAGCATCAACCGCGAGTACGACCGACTCACCGAGGAGTACAGCAAGCTGCAGAAGAAGATAACCATCGGCGGAGGCGGAAACAAGGATGATTAAACTCACTGGAGCCAAGTCCAACATTTAAATAACGATAAGACTTATAAGCATGGCGGTGGGGCAGCGAAAGCAGGCACATTTAAAAGATTATAACGATTTCAAATCGATAGAAAGCACACACATCTTATTGTTAATCCTCATAGATACAACTACATATACCATTTGATAATGATAATGGGGTATATTGATAATGGTCCCTCAACTCAATGTTCGTTTCGTCCGAAGTTTTGTATTTAATTCGTATGTGTTAAGTTTTGTTTGCCACAGTAACACACCCAAAAAGCGTCGTGGCTATTAAAAGAACAACCAAAAAGTACCCATCCAGTTGTGATCGATTCGATGATTCATCTGTTGGCGCGGATAGTCCACATCATGTCTGATAGTACACGGCAATGACGTCAGACGTCGCAACCTGTTTG


Search Again