Insertion Rab32WT03

Rab AA Change FlyBase Record BDSC Stock # Lethal
Rab32noneFBti010086823282no

Cyto Location (R4) Strand GBrowse
27F12L: 7,307,138minusmap

5' Flanking sequence:
CCGGTTCAGTGCCAACGCTTAACTGAAACACACGGTGCGTTCTTTCGTCC
GACT

3' Flanking sequence:
GTCCGACTCTGCGTTTGTCAGCAGCGACCCGAGATCCCCGATCCGATCGC
ATCGTCGGTCTTCGTCTTCGGATCGCATACACGACCGCCCGATGGTGTGT
GTGTGCGAGTGGGGTGGAGCTATACCCTGACTCCTGCATTGCAGCTGCGT
GCGCCAGAAGAGCACCGCTATATGGCGCGGTGATCGTTCGTTCTCCCTGT
CTCTTCGTAAACGTTTCTTGTGTGTTGCGCTTTGAAGTGTGCGTGCGTGT
GTGTGTGTGCGGTATATAGCCAGCATGGCCCAATAAGAAATGGCGGAAAT
GGAAAAACTCTGCCCGG

Return to Rabs Page.