P[acman] BAC CH322-94C04

CH322-94C04 is on chromosome arm chr3R from 10749762 to 10769196.

BACPAC Resources is the distributor of clones for this project. Investigators requesting a clone will need to establish an account with them. They will also respond to all questions regarding shipment and availability.

Return to the Browser

The sequence for the BAC is deduced by extracting the sequence from the reference genome between the alignments of the BAC end sequence. The sequence of the BAC has not been confirmed over its full length, nor has the sequence been aligned to the MboI restriction sites (GATC) used in the BAC library construction.

>CH322-94C04 19435bp
CGTCTTCTAACCGTTAACGAAGAGGCTCTCGACGAGGTGGACTTGGAAAA
GAAGCGTGCCCAGAAAGCCGATGAAGCCAAGCGTAGGGAAGAGAGGTGGG
TGCTCACTACCTACACCAGCTCATAGCTCATTTCCTATTAAATTTTTGAT
GTTTCCGAAGGGCTCTCAAGGAGGAGAGGGATCGCCTGACGGCTGAGGCC
GAAAAGCAGGCTGCTGCTAAGGCCAAAAAGGCTGCCGAGGAGGCCGCCAA
AATCGCTGCCGAAGAGGCTCTCCTGGCTGAAGCTGCCGCCCAAAAAGCAG
CCGAAGAAGCTAAAGCCCTAAAAGCCGCTGAAGATGCTGCCCAGAAAGCT
GCCGAAGAAGCGCGTCTAGCGGAGGAGGCTGCCGCCCAAAAGGTCGCCGA
GGAAGCTGCCCAAAAAGCTGCTGAGGAAGCTCGCCTAGCAGAGGAGGCAG
CCGCCCAAAAGGCCGCCGAGGAAGCTGCCCAAAAGGCTGCCGAAGAAGCC
GCTTTAAAGGCAGCCGAAGAGGCTCGTCTGGCTGAAGAAGCTGCCCAAAA
GGCCGCCGAAGAAGCCGCACTGAAGGCTGTAGAGGAGGCTCGTGCCGCCG
AAGAAGCTGCCCAAAAGGCCGCCGAAGAGGCTCGTGTCGCTGAAGAGGCT
CGCCTGGAGGAGGAGCAGCGTGTCCGTGAGCAGGAGCTGGAGCGCCTGGC
GGAGATCGAGAAGGAGAGTGAGGGAGAACTTGCTCGCCAGGCCGCCGAGC
TGGCCGAGATCGCCCGCCAGGAATCCGAGCTTGCCGCCCAGGAACTGCAG
GCCATCCAGAAGAACGAGAACGAGACCAGCGAGCCTGTGGTCGAAGAGCC
CGTCACGCCCGTTGAGGAACAGGAACCGATCATCGAGCTCGGCTCTAATG
TTACCCCCACTGGTGGTAATAGCTACGAGGAGGATCTCGATGCGGAGGAG
GAGGAGGACGAGGAAGAGGAGGAGGAATAGATTCTACACAATCACCATGC
TGTCAACCTAATTTAAAAAGAATGAAAAAACAATAAAAATATTAGAAAAA
CAATTTAATAGGGCAATGGGGTGGATAATGCTGGATAAGGTGTCACATCA
ATTCATAAATTCATCTTAAATCAATACAATGTTGTGTTCTAAATTTAGTC
ATAAAATTTGCTGAATAAATCAAAATTAAGATATCATATTCTTTCTAAGA
CATTTCATTATAAAAGTTATTTCTTATGTTCTAAAGTTCTTGCTAACTAT
ATAAAATTCAGATATGTAAATAGTTCTATTTCGTTATCTGCACTTCGGAC
TTTTTCAAACTTGGCGCCTAATAATAACATAACGAATAAATACCGAAAGA
AAAATACCGTGATATACTAAACTAGCATTTTTTCGAAACTGTTTATTCGA
CCGCACTAAATTTACGGCAAAACAACAACAACAAGCAAAGCCGAAAACGG
TACAAGTGGCTTTGCAAATTCGTTTTTAATAATTTAAAGCAAACAGAATG
TCGAAGGAGGATAAGGAAAAGACACAGATCATCGACAAGGACCTGGACCT
GTCCAATGCTGGGCGAGGCGTATGGCTGGTGAAGGTGCCCAAGTACATTG
CCCAGAAATGGGAGAAGGCGCCGACGAACATGGACGTGGGCAAGCTCCGG
ATAAACAAGACACCTGGCCAAAAGGCCCAGGTCTCGCTTTCCCTCACGCC
CGCCGTTTTGGCTCTAGATCCCGAGGAGAAAATACCCACCGAGCACATCC
TGGACGTGTCGCAGGTCACCAAGCAGACGCTCGGCGTATTCTCGCACATG
GCACCGTCCGATGGCAAGGAGAACTCGACTACCTCGGCGGCACAGCCGGA
TAACGAAAAGTTGTATATGGAGGGCAGGATTGTGCAAAAGCTAGAGTGCC
GACCCATCGCCGACAACTGCTACATGAAACTAAAGCTGGAGTCCATACGC
AAGGCATCGGAACCACAGCGACGTGTGCAGCCTATCGACAAAATCGTGCA
GAACTTTAAGCCTGTAAAAGACCACGCACACAACGTGAGAACAATAATAC
ACTCTGTTTTGGTAATATATATGTATATATAACTCCTCCATTCCTGCAGA
TTGAATATCGGGAGCGAAAGAAGGCCGAGGGCAAGAAGGCGCGCGACGAC
AAGAATGCCGTGATGGATATGCTCTTCCACGCATTCGAGAAGCATCAATA
CTATAACATCAAGGATCTGGTCAAGATCACCAACCAGCCGATTAGCTACC
TGAAGGAGATTCTCAAGGATGTCTGCGATTACAATATGAAGAACCCGCAC
AAGAACATGTGGGAGCTCAAGAAAGAATATCGCCACTACAAGACTGAAGA
GAAGAAAGAGGAGGAGCACAAGTCAGGCAGCAGCGACTCGGAGTAGCATT
GGGAGAATCGCCGACTTACTTTCATTAAAACACATTAAGTAATTGCATGG
TTCCGTTTTATTCCTTAAGAACTACACGTTATACTTACGAAAAAAACATT
ATATCTTAAAATGATTGTAAATAGACACTAGCTTGCACTCTGGTAAATAC
ATACGTATATATACACTTTATCCTTAATTTATCTTGAACTTTGTCTTATG
TCCGAAGAGTTCTTATGTTTATACTTTTGTACAGACGAGATCAGGTACTT
GAATTTAGTACTATCAGCTCATGAGGATTTCCAAAACACGCGCTTCGTCA
ATCAAAAAGTCATTTGTCTATTTTTGTTCTAAATCAAAGGAGGTATAGTG
TTAAATTTTTAGGAAATCATAGAAATAATAAGAATACGAAATAAATCTAT
TCGTAGGTAAAGTAAAATAAATCAAAAATGTTCAAAAGAAATAGAAATTA
ATAAAAATGTGAAAATTTCATAAGCAACTAAAAGCGTCGTAAAAAGTTAA
AAAAGTGAAGTGAAAGAAAAACTAAAAAACGGCTTCATGCTTAGGAAAAT
CGAGCTTAGATAATACTGGTTTACTACTCTAAAGAAATATTGATTCATAC
ATCGATAAGCTTAAGCTAAAGCATTCTTTCTATTGCAAGCTTCCTAATAA
TACGTAACTAAAACTTACATTTGTACACGATTGCGGGTAAATAATCTGGC
AAGAACATATATCTAATGCAGCCTCTTGATCTTGTTGTACCGCATGGGAA
AGCGCATTGATCTCTCGGCCTGAAAATAATATACATAAAAATTGAATTCG
AATAAGGGGGCACACAAACTAGACTCTACTACTGGGTCAGGACGCAAGGA
ATCTTATCTACAAAGAACTACTAAGCACATTTAAGACGAAACACGGCTAC
TACTTCAGGCGGGCTGTCGATGCCAATGATGAGCCCATCGAAGATATCCC
CGAGTCGGCATCAGAAGGAGTAGGCCACATCTTTGGGATGGGCTGTATCA
ATCGCACAGTTTTAGCAAACACCTCGGATAAAGAATTTTCCGCAGACTTT
CGTTTTGTTGGTGCAGATGCCGTCGTGCTTGTTCGTGGCTTGTGAGCTGA
ATCATTTAGCTGTTTACTTCTCGGCGTCGATTTGCTCTGGGCAGCATTTA
TGTTGCCCACGTCGTCCTCGGGATTAATTTCCATTCGCTTCATACTCTTT
AAATGCATTCGAAACTGAGACATGTCGATGGGCTTACTTTTATCGCGATT
TTCAAAATCCAGAGACACGTTTCCGTGGTTCGTCTGCAAATGAGGAGTGT
AAAAATGATTGCTTATCGAAGGACAGCATTTTGATTGAACGCATTAACTT
ACCAGTACCAGGGAAGCCAGCATGTAGCGACACATGATACTAGGATCCTT
GTCAGCCATGACGTCGGCTAACGTGGCTGTTCTGTTGCCCGCCTTGCAAA
TGTCCAGGATCTCGGTGCCCAAGTCCTTAATATTGAAATTCTGCCGTTCA
TGGGCTGCTTCCAAAGCAGGAGCCAATCGTCTATGCCAGTCCCGGATCTA
AATGGACAACGTTAGTATTTTTTTTATAATTTTATATCCAATATTTACCA
ATGAGCAGTCGTCGACTGCTGAGTCGGCAATTGGATTGGGTGTTTCAGCA
GACAAATCATTTGCATCTGCTTCGTCATGTAAGGTATCTTGGTCCTGCAC
GGTTGAAATCTCTAGGTCTGAATTGTCAGGTTGGGTGACATTTATAATGT
TACTATCCATTGCACTCGGTTCGGTACTTAAATCCAATACAGAACTAACT
AACGCGCTCTCCATTCCTAAATCCACTGTGGTTTCCAGTCCGCTTAGCGT
TCCGGAGGATTCTGTAGCAGTCACTTCAAGTTGCGATGAATTTGCGGTAT
TGTTTTCCGCATTGGGTTCGGTGGAAGCGTTTAATTCCTGCGCTAGTGAA
TCTCCCAGCCCACTTTCCTTTGTATCGTTCACATTCTCATTCAAGGCGTC
GCTGGCGCTCGCGTCAGTTAAATTATTGGTGTTGGCTTCAATCTCATCTT
CAAGCTCAGTTTTAACTTCTCCGATAGTGGAGACACAACTTGATACACGC
GGCTCTTCGATATCGAAGCCCGAGTCAAATGTGGGTCGACGTTGGCGGAA
ACCCAGAAAATCTGGTAAGATATGTAAGATAGTTTCGCGACGTGACATAG
TGTGGCAAAGTAACTTACTCAAGTCCTCATCAAATTCTAAACTACAGGGG
GAGCCGGGTTCTCTTTCATTTTGGGGAGCCTCTCTTCCAATTTGCAGTAC
AGTTCTGGGAGTGGTTGGGGATTTTTGTTGTCCCTCTCGCTTAATAGGAA
GGCGCTAAAAATAAAACACATATGCAGTTCAAGATTTTTTTCCAACAGTG
ATGTAACTACTGAAAACACTTACTGCTTGCCTGAATAAGTCGAACTCAGG
TGGAAGTTTAAAGATGCATTTCCGACGCAGGCGTTTTATGGGGAGACCCA
TAACATTCAGCAGAATAGGATAGCTCACCTCCCTTGGAACATTCATGATA
AGATCAGCATCCATCTCAATGATATTGAGCGTTTTTGCCTCCATCGATGG
GCTAACCATCTGCAACATGGGCGACAACTGGCGTTGATCTTCTAAATCTG
AAAGAACAACACCCTCATCATCAAAAGACTGGCCTGCTGTGACAAATGCA
ATGCAGGGATGCAAGTGTTTGACAAGTGCCAAAATAAAAGAGTAAAGAAA
AACAAATATGTAAGTATTTGAAATCAAAAAATAAAGGATTAAAAAAACCC
TTATCCTTAGTACGCTTGGCGAGCGTTGGATTGCCATTGCTTTACCTGTA
TGCATTTGAATATCGGAAAGCTCTTCCATACTGATCCCTGAATCGATTAG
CAACAGTTCATCTAGAGTGAGATCTTTTATGGGATCCACTCTCGTGCTGT
CGAGAACACTAGACTCGTTAATGGCTAATGTGCTGCTCAGCGGAGGATTC
TCTTCTTGGCTATCGCTTAAGGAGTTTTCTATATGGCTGACGCTTAAAGT
CGCCTCGACTTCGCTACTCTTTAAAGTAGAGTTCTCCGCCTGACTGATGC
CCATCGTAGACTCGGCTGTGGTTAACGACCTGCTGTTTTCATCCACCAAA
GATTGGTCAATAAGAACAGTTTCGTTCGTGTCCATTGGCAGATTCTTGTC
CATGCACATTTTTTTCGCCAGTCCCTCATCCAAATTGTCCTCCATAAATC
TCGCGGAATCAACCAATCTTCTTCTCCTTGTGACAATGGCTCCATAGCGG
GCTGCTAGCATTTGATTCTCCAGCGCAATATACTCGTCCAGATATTCCTT
TGTGGTCATGTGCTCATTAAGAATCTCAGTGGTGTTCACCTGATTTGTGT
GAACATATTCTTTAATGAGATTCAGCCTTTCGAAGGGAATATCTGGCAGA
AGCGTATTGTATCTATGCTCTACGTGATACGTAAACATTTTGTATTGCTT
TTTCTCATCCTGGTCGTAGGGATTGTGAGGATCCACAATTGGCGCGTGTT
TCCACAGGTTGGGCGGCGTGTGATCCTGATAAAGGTATTCTATCGTCCGA
TTTCTCGTGCACTTTACAAAGCCCGCCGCGTTGAAGCGCTTGTCGTCCGA
CATGGTTTTAAACCTTTTCGGTTCCAACGTGAGCAAATAGGGATCAACTT
CCTTGTTAGTTAGCTTTTTAGGGTGACGTTTGCGCGTTTCCTCAGGCCTG
CGCTCGTTTTTCTCCGGTCTGTAAATATGAAAGGAAAACAATTATTATAT
CGCTAAATGCAGATTAAAAGAGGATAAGATTTCTTTTTTTTAAAGGACTG
ATTATTATGTAACTTAAATATTATAATGAAATCATCTTATGTTTAATCAA
AATACTGGTGCTATCTTTAAAATTAATTAGACTTTCAACATTTAGGTCAA
ATAATCTCCCCAAATTCTTTAATGCCGGCTGATAAGAAAGAATTTAAGTG
AATTATAATGTAAAAATATTTATTTAGGATGTGATCTATCTCTGAATAAC
TTGTTATTTTTATGAATGAACTGTCTACGTTTTTAGCTTCACTTGTCTGG
TTAATTTCTCATTTCTTTATATACTCTGTTTGTTATTTGTTTTTGGAAGC
ACGAGAACGTGCCCTATCGTCCATTAACGGCAAGCCGGCTTCTGTGATAT
TAATGCAAACAAAGCCGAAGGGGGCGTAAAGTGAAGCTCGATAAGCGGAA
TTCTGGACCGAAAAGAGCCAGCAATGGCGACAAGTGGGGAGCACGTGGCC
TTGTCTTTCTCCATCTTCTTAACTCTTCAGTTCTGAGTTAAACTTACGCA
GCACTTCCGCTAGGGGTCTCCTTCTGCAACTCCGATGTGAGCAGGGCTTC
GATCTGGTGCTCCACCACCTGGCACAGGTACTCCACTCGGTCTCCATAGA
TCTTGCCGCAGTACTGGAGGGCACTTCCTGCGGCCACGATGGCCGATCTT
CGAGAGACATCATTTCGTCCTAAGCAGTGGCGCAGTAGCTCTTCAATATA
CTGAAAATATAAGCAATGTATTTGAGGATCTGCAGGCTTTTGTGTTCACT
GTAAATAAAATAATAGATTTTCTTGAAAACCCATTTATATAATTTTAGTT
AAAATACCAGTTATCGAGGCATGACTGTAAAACCCACGCACGTTGCGTCA
CACTTTTATTTTGATCTTTCTGCTCTTCGGCGGTTTTGCTTATCTTGATA
ATAGTGGTCTTCAACACTCACATATCCCAGTGATATCCGTAGGTCCGTGG
AGTAGTCCGTGTTTTTGGAGAGCTCTTCGAGGAGGACGACTAGCGAGGCC
AGGTCCTGTTGCTCATCGTAGGCGCGGATGCACTTGGCCACTTGGGTTCC
CGGCCGATTCTTGGCTATTTCCAATATCTGCTCCCGCGCTTCGCTCAAGT
AGGCTGTGAATTAAATAGAAACCGATTGGATTTACTTAAGCAAAAACCAC
ACACCCAATCGCAGATCCGCTTTATTGTTTATTTCGGCCCTCCCCATACA
CACACACACACACTCGCATAGAAGCACCAACACACGCGGTATACTGGAAA
TAGCGCTGACTTAATCAATGGGAAACGAAGATCACGCCTGGGGCTGTCCT
GCGTTGGTTACCTAAGTTCTGGATGCTTACCCGCTTCCGCTTCTTCAGGC
AAAATCCGCTCCATGGCTCACTAGATGACACTAGGAAAAGTTTGTTTTAT
GTCCGGTTTTGCACATTTTACTGGCATCGTGCACAAGCACTGCAAGCACG
CACACACGCTGAGTGGGGAAATCAAAATGGTGGAGGCAGCACGGCTTGTC
TCTTAGTTGGGTCCAGTTATGTTATGGTTTTACGTTTTGTTTTCATTTCT
TTGGCAGGAACAGGAATATTGGCGCGAATCGGTGCTGGAACAATTAGCTA
TTCACATCAAGATATATATGTGTTTCTTATTTTGTTGTGCTCTACCGACG
AATGAGGGAAGAGACGGAGAAAAATTGCTATGGCAATGCTGTAGGGGGTG
CATGCAAGCATGGTCACCTTTAAGTTATCGATAGCTAGGCACGGTGAATC
ATTTATTATTTCGAGCTCGATTAATATCTAATTTAATTTTTGTAATTGTA
AATTATTTGTCAGTGTCTCAAAACATATTATAATAAATTCTGCTTATTAT
TGCATTGTCTAGCTTCAAACCTCTAGTGTGCTCATTTTTAAGAAAACAAT
TTGAGTGATAGTGTCATCACTATCGTGAGTGATTCGCCTGTCTCAGGTGC
CATCACTTCTTCAAAACAAAAATCATTTATTATTTTTGTATTTCCGCACT
TGTTAATCTCATAATGTCCAACCAGGAGACCCAGGTTTCCAGCCTGCCGA
TGCCGCCGGAGCGGTACATCGCCAATTACACGGACGAGAATATCCGCCGC
AACCGAGCGCCACGCCCACCGCCGCCGCCGGCGCAGCACGAAGTCTATAG
CATGTTTGGCATCCAGTACAACAACGACGAGATGATCCGCAGCTTGGAGT
CCCAGAATATTAAGCGACTGATCCCCATCCATTTCGATCGGCGCAAGGAG
CTCAAGAAGCTTAACCACTCCCTCTTGGTCAACTTCCTAGATCTCATTGA
CTTTCTTATCCTGAATCCTGACAGCCCGCGGCGCACGGAAAAGGTGAGTC
AATTGACCCATTAAAATGTAGCATCTATTGTATTACACTCATTTGATATC
TTAGATTGACGATATCAGTCTGCTGTTCGTCAACATGCATCACCTCCTCA
ATGAATTTCGCCCACATCAGGCGAGGGAAACGCTGCGCGTCATGATGGAA
ATGCAGAAGCGGCAGCGCGTTGAGACCGCCGCCCGTTTCCAAAAGCACTT
GGAACGTGTGCGCGAGATCGTTAATACCGCCTTCTCAGCTCTGCCGGTTC
TAGATGATGACGACGATAGCGGCGGAGCAAAGATTAAGACGGAGGTGGAT
CCGTTGGAGGCGAATGCGGCGGCCAAGAATGATCCCAGTTACCAGCACGA
TCGCATGTTGTGCAAGCTTGTGGACGCTATCGAGTAAGCTGAGTTGGCAA
AAGACTGGACATCGACGCTGGAAATAGTGTCAATCATTGTGAATGGCTTG
GAAAAAAGAGCTCCTCATATTTATAACTCCTTTTAGTATAAGAAATAAAA
CCCCAATTGTGGGATGAGAATCTTGCACGTCTAATGAGTAATTCATTCAA
TGGGAATTAATGTGTTAAGTCATCTTTGAGATAAGCTTTACACAGATAAG
ATCCGAGATAAAGGCTCATGATTAAGCATCCCACAAATTTCACCATTAAA
ATGACGTAGTCAGCGTGGAGTAATAATATAGTCAAATGTCATAAATTAAT
AATCTATCTAGAACAATTTATTCAGGATAGGAATAACAATATAAATGTAT
ATATTTAATTGTAAAAATTGTAAAGACATGTGACATGACATGAGACATGA
ACACCTCACACGTTTTCCTACTTTTAATGGGTGCTACCGCATGGCATCAT
CGTGGCTAGCCGAAATATGCTCGTACAGTGCGTTTCATAATGTACATATA
CATATGTGGTTTTAATGAATTTGTATGGAGTTTCATCAAAATTACTAATT
TTGTTTGATAAACATGATTAAAAAGTCAATAGAGATATTCATTCACAACT
GGAGTATAATGTTTTCCCTAAAATTTTTTTAACTCACTGTGCCCTTTACA
AAATCCAACGTGTTTTTCTAAATAAACATGGTTTAATACGTTTATTAGCT
TTCTTAGATTGTAAAGCCCGCGATAAGAGAGATGTAGTTAAGTGAATCTT
CACTTTTATTGAAGTAATCTCCGATAAAAGGAGGTGCCATGCGCTCTAGA
TGATCATTTCTCGTGCAGCATTGCAAGTGTGCAAGTCGGTTGAATAGGAA
TATTTTGAAAACCCTTAACTCATTGACTTTGAACTTAATTTTTTAAAGAA
CTTGTGGTTGCGCTTTTTAATTAAGAACTGCATCGTATTAATTGAACAAT
CAATTTCAAGAGCAAGCCGATTGTGAAAACCCATGGTGACAAACAGTAAT
AGCTAAGATGTCGGAAAAGAATATTAAAACAGCGATTCCAGAGAAAAGCA
AAGGTAAAGGGTTAAAAAATAATTGGCAACTAACTACGATGGAGTAGAAA
AAACCTTATAAACCCAATAAAACAGAGCTTCCTTAAAAAGTGCATTGTTT
TTAAGAAGTATCATGTAATAACCAGTCGCAAATTAACTGAAATGTGTTTA
TTGTGACAAATTTAAGCGTAATCTTTTATGACACTGAAAAATAGACGTAA
AATTATGTGATTAGTCGTAATCTGAGTTTCTAGAAATTTATCATAAGTGC
CTTAAACAAGTGTGGAAAAGTTTAGTGTTAGTGGTATGAAATTATAGCCC
CATGGAATAAGTAGCCCTCTTATCGATTTAGGACTAGAAAATGACAAGGA
TGCTGATGGTAATTCAGATAGTACCGCGGAGGCAGAAGCCACGCCCACGG
AAGAAGGTTCTGCCACCTTCGACAAGGCGATCGAAGGAGCTGGCTTTGGA
ATTTTCAATCTGATGCTGCTGATCGTCTCCATTCCCGCCCAGAGTGCCGC
AATATTCGAGTCCAGCTCAATGTCCTACATCCTGCCAATTGCCGAGTGCG
ATCTTCGTCTGACTCTGGAGGACAAAGGTGTGCTGAATGCGGTGGCCTAC
GCGGGCATGACCATCTCGGCCATTGCCTGGGGCTATCTGGCAGATACGAA
GGGTCGCAAAAAGATCCTCTACTGGGGCTATCTGATCGATGCTGTGTGCG
TTTTTGGCAGTGCCTTGAGTCAAAACTTCAGTATGCTGGTGATGTTCAAG
TTTCTGGGGGGCTTGGTGTAAGTATTGAGTAATCAGTTTTATAATTTAAT
CGTTAATTTATATTTTATTAAAGGGTGAATGGTCCGGCTGCTGTGCTCTT
CACCTATCTGACTGAAATGCACGGACCCAAGCACCGATCCTCTGTTCTGA
TGATCGTGGGCATGGTCACCTCTACGGCGACGGTTTCGCTACCTCTTTTG
GCCTGGGGAATTTTTCCCAGAGATTGGGACTTTGAGTTCTGGGGCTTGCA
AGGTACGTTGCCGTCATACTTATTGAAATGTTAGATTATTCTAATTTAAT
GTATTTTAACTCAGTCCACAGTTGGCAAATTTTCCTGTTCGTGCTGGGCA
TTCCAAGTTTGATCAGCGGTTTGATTTTCTGCAGCATGCCGGAAAGTCCG
CGATTTTTAATGGCCCAAGGACGGAACGAGGAGGCGCTCCAAGCCTTTAA
GCAGATCTACCATGTCAACACTCGCAAGCCCAAGGATAGCTATCCCGTAT
GAGAATATTCAAAACTATAGACAGTGTTTAAAAATTTAATACGAAATCAA
ATCCTTACAGATAAAAGCTCTCATTCAGGAAGTGCCCAATCGTAAGGCCG
CCCAGAACGAGGTTATCTACACAATCGAGGAGAAATCCGGAGAGGTGCCA
ACCAAGCGACAGTCTCGTACCCTGGCTGAGAGCCTCCGAGCCGGGCTGCA
GCAGATGAAGCCGCTGGTCAGGAAGCCCCTGCTGGGTTTGGCCATTTGCT
GCTACGTGATGCAGTTCGGCATCTTCCTGGGCATGAACACCATCCGTCTG
TGGCTGCCGCAGCTCTTCGCCTCCATGGCGGAGTACGAGGCCCTGCACGC
CGGGGACGGATTGGATGTCAGCATGTGCACCATCCTCGAGTTCAGCGTCA
ATCAGACGGCTGAGACAGCTCTGAATTACGCCGACGCCTGTTCCGAGGTA
GGTGACAGATAGTGCTTGGAGATAGCAGATCTAGATCTGGTTTTGATCTG
CAGATAATGCTTGGAGATAGCAGATCTAGTTATGGTCTGGATCTGTAGAT
TGGGCTTATCTGCAATCTCACTTAACGCCTCGTCATCGTGATCGTGACGT
GGCTATCTCTGAACACAAAACGAAAGATAACCATAATCGTTTATAAATGT
GGAAGTTGTATACTACAATAGTTTATTTGATAGTTACATGCAAACTGGAA
GTGATCTTTCTTGATAAAGCTTCTAAAATTAGCCCCTTAATTTATTTTTA
TAGCCCAAGGTAATTTCGATGGACATGTATCTGAATAACATTATTGTTTC
GGCCACGGGCTTTGTGGGCTACTTCTTTGCCGGTGGAATCTTGCGGGCTC
TGGGTCCAAAACGCATGATGAGTAAGTTGCTCCCGAAATTGTATATCTCT
TTGGTGATATAACTTCATATAACGTACTTTCCAGCTTACGGATTGTTTCT
GTCGGGAACCTTTGGCCTGATGCTCTACTTTTCCGTGAGCAGTCTAATGA
CACTCATTGTGTCTGCGACTTTTCTTACGATTACGGGAATTGCTGTCTCT
TCACTTTTGGGTGCTGTGGTGGCCCTGTTTCCCACACAATTGAGGTAGGT
TTTCCATTAATGACATCGAAATCGTATTAAATGAAAGGTTAACATTTGCA
GAACCGTTGTTGTTGCCATTGCCATGATGTGTGGACGCTTTGGTGCTCTG
TCCGGAAATTTACTCTTCCCCGTATTCGTTCAAACCGGATGTTTGCCACC
ATTTATAATGGTGTCCTCAGTGCTGATATGTAAGTTGAAGTTAGTTTACT
CTCTAATCATTTTTTTACAACATTTTTATCTCATTTTATTGCAGTATCTG
GCATCCTGTCAATATCTCTGCCTGATCCGGCAAAGGCAACGTTTTCTTAG
AACAAAATAAGAAATACAAATAATAAGATAATAAAAACTAGACCTAGGAG
TGCCCATTTAGAATCGGATCTTGCGACATTAGCTTTTGTTTAGTTTTACA
AATTAGAGATAACGACTCAACTGGATAAGATAGGCGCTGAACAACTATTT
ATACATACCCTAAGTAATTAAACCAAATATATCTTTACTGTTGTACAAAT
TACGATGTTATGAGAGCTCCATTCAAGTTCCTACGTGCTTAAGCCAGATG
GGGGCAAATACATATCTGCGGATCCCTCAAAGGACTCCACTGGTGGGCAA
GGACAAAAGACGGCGGAAGTTGGAGACATGCAAATCTCATTAGCACTAAT
TAAGTGTATCAGGCGGTATTCAGTTGGTTTGGCGTTTTGGTGGGTGGCTG
TGTTGGCAGGTAAATTGGCAGGTGAGTGATCAACTACAGATAACATTAAA
CAAAGTGGAAATTAGTGCTGCCTGAATTGACTTATCGTAGCATCCTTTAA
GTGGATGCTATTTATCAGATTGAGTGCATTAGTGAAACCCAAACAACACG
AACTTTCACCAAATGTGCACTCAATGTTAGCCTCTTAATCTTAAAATATT
GAATAAAATTGCTAATTATGAGTGCTGGCATGCCTTTTATTTCTGGAAAT
GCATAAGTATCTCTCAAATTGCATAGAAATAGGAACATAACGAGATAATG
TACTGAAAACAATGATCTAGCGATAATTATTACCTATAATATTTGATTCA
ATTTTTCTTAGTTATAGAAAGCATATTGAGTATCAAGTACACGAATTTAT
AAATTTTAAAATCCCATATGCCACAATATTTTGAAGTCCCTTTCCATTTC
GTAACTATCCAGGAGTCTTTCTAGTCATTTTCAAAATTTTCACTGCCCAC
CCCCAAAACAAAATATTCTTATTAATTGTAAGAGATGGCGGATCGAGCAA
AGGATAATACCGATGAGCCTGCTGACTTCGAGACGGCAATCGCAGAGTGT
GGCTTTGGGCTCTTCAACGTGTTCATCCTGTGCAGCGCGGTACCCTGCCT
CACGGCGATGGTCTTCTCGGCCTCGGCGCTGTCCTATGTGATGCCCTCCG
CCGAGTGTGACCTTGACCTGAGCATCGTGGACAAGGGAATGCTGCATGCG
GTGACCTATGCGGGCATGATCATCTCGGCGGTGCCCTGGGGATTTATAGC
AGACACCATTGGACGCCGACCCGTCCTCATTTCGGGCGGCTGGCTTGATG
GCTTCTTCGTCCTGTGCGCTTCGCTCAGCCAGAACACTGCCCAACTGATG
GCCTTCAAGTTCTTCGATGGTTTAATGTAAGCGGTTTTCCAAATTAAAAT
TAAAATGTTATCATTTATGCTATGAACTTCCCCATTCTAGCATCTGCGGT
CCATTTGCGGTCGTGGTCAGCTACCTGGCCGAGTTCCATGGCAAAAAGCA
TCGGCCTTACATCATGCTGTTCGTGGGTCTGTGTGTTTCCATTGGATCGA
TGATTTTGCCCCTGCTCTCCTATTTGCTGCTACCGGTGCCCATCCTTTTC
ACGGTCTCCTCGATGAAGTGTGGGTGAGAGTCCTTCACCATCTGCCCTCA
ATTATGAACTTTACTTTCTGACAGCAGTTCGCACCTGGCAGGTCTTCCTG
GCGGTCAGCTCGGCGCCCAGTCTGCTCAGCGGTTTTCTGCACATCTTCCT
GCCCGAGAGCCCCAAGTTCCTTATGTCTCAGGGAAATTATAAAAAGGCTT
TGGACTCCTTGCAGCGCATCTACAAGCTGAACAAGCGGAAGAGCAGAGAG
AGCTATCCGGTACTAACAATTTTTCTATACGTTTTCCTATTTTTTTTTTT
CAAAATAATTTATTATTAATTTAACAGATAAAACATCTCACCGATCCCAC
GCCCGATCGGTCTGATGATCTTGATGGTACTGGTCGGCCATCAACACTCC
AGGAAAGATTTAGTCGGGCCCAGAGCAAGTTCATCGATGGATTCAAGCAG
CTGAAGCCTATGTTCTCCAGTCCCTACTTGGCCATTTCACTGCAGGTTTA
TTGCCTGCATTTCTGCCAGATTATGTGGTAGGTATCTTTGGTATCTTATG
TGATTGCATTTTGTATATACATTATCCTAGTGTCAACTCCGTGCGTCTGT
GGCTGCCACAGATCTTTGCCACGATGAACGCCATGGACACTTTGGGTGCG
AATGACACGAGCATGTGCGCCGTTTTGGAACACAATGCAAATGCGAAATC
CATGGATGAGGAGGAGAAGAGGGTGGAGTGCGCTCTAGTGGGTAGGAGAT
CGCTTGTTATGGGCTTCCAGAATCTAAGGTAATAAATTCTATCGTTCAGC
ATCATGATCCGGATAGCTACTTGAATAACATCACGGTAGCTGGAATTGGT
CTGGTCGGTTTTCTGATCATTTTTCCCTTAATGCGATTCCAAGTGGTCTC
GAATCACATACTGAGTGAGTACTGTACTTATACTTGGGATGCAACGCGAG
TCTTAAATATTATAAAATACCTCAATGACTATGCTAATAACATTGATTTA
TTGTTCGTTTCATAATGTCAATTGGAAACATTTCCAATTCGAATTTGCAT
CTCCATTTGAATTATTTATTTATGTGAGCTCCTGACAGAGGTGTTCCTAT
TCATCTGCATTTTCCTGGTGGGCAGCCTGTACTTTGTGAAGACTTCGCTG
GTAACGATGATGGTTTCCGCCGTTTACCTGACCATGATGGGCATTTGTGC
CACTACAATCATTGGAATGTCTGTGGTGATATTTCCCACCCTAATGAGGT
TTGATATTCATAATAACAAAAACAAGATTAACATCTTTCTTTATTTGCCA
GGACGATGGTTTTACTGCTGATCATGACCTTTGGGAGACTTGGATCTGTA
AGTGGCAATATGTTACTGCCGGTTTTCATGCAACTCAGCTGCTTGGCTCC
GTTTCTCTGGCTTTGCTCACTGATGTCAAGTGCGTAGTATTACATTTAAA
TAGGTGAAGTAATTATCAGATAATCCCTATTCCCTTACCGCAGTTGCCTT
TCTGTTTTCGCTGTTCCTTAAAGTCGACGATGAGCAATCACTTAACTAAT
CTTGGCTGTGATTAATTGTATCCCTTTCCATTAATTCTGGGAGAATTAAT
AAAATTAATAACAAACAGTCGACTGTGTGGTTAATTTTACTTAATTACCT
TTGAATCACAGACAAACACATGCCAGACGGTTCTGATTAATTTCTTGAAG
CCTTTTGATTGGTGGGGAAAACATATATATCTGCCGGTAATTATGTTTTT
GCGGTTACCAATTAATTTGCATATGCAATGCTGACTCGCAGTTCGCGCTT
CGCTGGCTGCCAAAGGGATTTCCACCAGCACATGCCCTCTGGCGAAAACT
TTTCCCCTGCATATTTTTCTAACCGCACCGCAACCATAAATCAGCACTAA
AGTTTGTTGCCATCGACTGGCGACAGAATCAATGGGAATCTCCCCATGAT
GCACACACGGCGTATACTTGATTTCGCACCAAGAACCGGCAACGAGAATA
TCCTATTTCCGGGCACTTTCCTCCTCGACTCGGGGAAACTAACCTATTTC
ATGTGTCAAGCGGTAATTGACACATGTTGACTTGGGGCGTCTCCCTTGCC
AGTTGTTGGTGCTATGGCTCCCAGATCGCACATATGGTTCCTCTGCATAT
TGAGACATGTCCTTAGTTCGGGCTGCACTTATTTCGGTTCAATTTATAGA
TGGTGTCAAACCAACCCACAGAAGACTATGAAAGCAATTTGCTGCCTTGA
GTCATCTATAGTATGTTTTTCCTACTCAGCAAGGGTATTCTAAATTCATA
GCCAATTCAGCATCAGTTTGGTTAATTAATTAAAAATGTGTAGTATGTTT
TTAATATTCACGAAACCAATGAATATCAGTCAAATGAAACTATTCAAATT
GGCACATCTAAGTATGCTACGAAACTATGCACTTAATTACACATTGGAAG
TTCCAATTTGGAACTAACGGCACACAACATTTGTTTCACTTTCGATTCGA
TTTCGATTTCGATTTATGCAGCGGGTATCTTTTTCACACTATCTGCTGGC
GGAAAAATTTGACTAAAAGCTTAATGCATAAATGTATTCCCCAAAAATTG
TGCAGACTGCTCCGTATTTTTATGGAGCTCTCTATTTTGAAAATGTAAAA
AAAAAATACCTCTGGCTACTCGTGCGCTCTATAAAAACGGCCAAACAACA
AATGCGCATAAATTTATCATAATAAACATGTATAAATCGCCGTGAATATA
AACAGGGCTAAAATATGCTTAGGGCGGCCTAATGGTGGGATGTGTTCTTT
TGGTGGGCGGGGCCAAATGTAAGCTATAAACTAAACGAAACAAGATCGTA
AAAAAAAGCTAAACAAGGAAATGCATACGCTTGTAAGTGTGTGCGTGCCC
CGGGCAGAAATGAGGTACATAGTGCTGAGTTTTTGGGGGGAATCTAAAGG
GACGAACAGACGGGATGTGAGTAGATCCGCCTGAATGGGCAGTCATAATC
ACATAGGGCCGAAAAAAGTAAACTTGCTGGGCAGATGGAGCGGCAGACAC
AAACATTGGCAGACATTAGCAAAACACAAAATACGACAAACAAACGTACA
CAATCACAATGGGTCATTGGAACGGTCCTTGAATTGTTCATTGTTCGGGC
AAGTGTGTGGGTGTTCCGCAGTAGGGTAATGTGTAAGTGGGGTGTGAACC
GCGTCCTCTGCCATCATTTACAGGTCATTCATCACAGCACCACGAAGTGA
AACCACACTTACACCCTCTCACCAAGTTTATGTAGTTGGGGTATCAGGTG
TGCTGAACAAGGGGTTTTAAGCGGATTTTGGAGTTTCTACAATGAAAATA
ACAACTTGGTAAACCTTCGATAATTTACTTTTGGCCAGCACTCAAGAAAG
TTTAGGAAGCCTTAGAAAACATCATATTTGCTTACAAGAGTTTTAAGCGT
TCTCGTAAAGTTGCCATTATAAGGGAGAGTTTATTTTACTAGACGAATAG
TTAATAACTTGAAAATTATTAAATTTACTTTTTAAAACGAAATTACCAAT
TTTTATTGTACAAAACATTCATTGAACCTATTTATTACTTGCTATAAAAA
CATATCCTGCAACATGTTGCCAGCGAAGTAATGTTGCTAGATTCTCTCAA
CAGGTATGTTTCCAGCAGAGGAACACTGCAGAATTGGTATTTTCATGCAA
AGCATTCAGTCGGCGGCGGCACTTGCAGCGCTAAGGACACGCGTAGCACA
GCGAACGGAAACTCGGGAGGCATTTTAAGAAAATAAGATTGTTGCCAACT
AACGGTGTTTTCGTAGTGTGTGCGTGTGGGCTTGTTGCCACTGTATGAGT
GTTGTGCTGGCTTAAAGCCAGCGAAAAGCGCAATGAAAAATAGTGGCCAA
AAAAAGTGGTTACAAGGTGTGCAAAAAGTTTGTAATGTAAATACAAGTGG
GTTGCAAAATATGTGCAGTGTTGTGATTTAAGAAATTCAATTTAAACGCT
ATTTATAGCATCAAATTGTGCGATAACTTTTGTAACATGTGATTAAAAGC
ATATTTTTTGTTCTAACGGAGTATAAATAGAAATGTTTTCTAAAAAAAAG
GGGCTTCATATAAAAACAAAATGCAGATTAAGGTTTTATTAGTTCGTAAT
CTTCTGGATAAGTGTGAATAATAATTGGATACAATTAAACGAAGTATTGA
AGTGAAACAATATACTTAAATGCAACCCATTTATGGAATCAAATTATTCC
TATTTGATTTTCGAAGCAAGTTTAAATATTTAACTATATAAAATCCATGT
GCGTTTAAACCTCAGATAATTTACTTCGACACTTAAACTTATATTTAACG
ATTGCAAGGTTGACAGTTTTGTGACCAAAGGGCCACATGCAGTGTTAAAC
GCAACTCGTCCTTGACCACAGGCCAAAATTAAAAGTGTGTGTGCATGTGG
CTGACAGTTCAAAGAACATAAAAAGGAAAGCTCCTTGGAAAACGCGCCAC
AAAAGAGGATCAACTGAAAGCACAGCATTTACGAAGAAATTAAGAGTCAC
CTTCCGGAAGAAATCCGTCGAGCTCAATGGTTTCTATGGCACCGCGTTAT
TAAATGTGGCATAAGTGCAGCGGGATCATTACGGAAACCACCCTCTATCC
TGATTACAGACTGCAAAATGTCGGAGATTGTCGACACCGAGCTGCTGGTC
AACTGCACCATCCTCGCCGTCCGTCGATTCGAGCTGAATAGCATTGTGAA
CACCACGCTCCTGGGCAGTCTCAACAGAACCGAGGTGGTCAGCCTCTTGT
CGAGCATTATCGACAATCGGGATAATCTCGAGAGCATCAATGAGGCCAAG
TGAGTGGGCAGGAAGTACTGCGTCCTTTTATTTAGCCTTCCAGGTACTTC
GACTCCACGCTCGCGTGCGTCCTTTATTTATTTCCACCGAGATCTTCTAG
CAGCCCCCGCACAAAGTTATGCAAATTAAACGGTAGAGTTATCAGCGATT
CGCGGAAGCGGCCAGTTTTCCCTGATGAAGGCTTAAATTGAATAAAGTTT
CGTGGGTCTGGCAGCTGATAAGCACATTTGGCGTTCGTCCGGTTAAGTCG
ATGCACTTGGACTAAAAAGTAGAGTTACTTATACAAATTAGGATACGCAG
CTATTGGATTTTCCTGCAAACTTTAATTGTTGATC