P[acman] BAC CH322-90E04

CH322-90E04 is on chromosome arm chr2L from 3569822 to 3589532.

BACPAC Resources is the distributor of clones for this project. Investigators requesting a clone will need to establish an account with them. They will also respond to all questions regarding shipment and availability.

Return to the Browser

The sequence for the BAC is deduced by extracting the sequence from the reference genome between the alignments of the BAC end sequence. The sequence of the BAC has not been confirmed over its full length, nor has the sequence been aligned to the MboI restriction sites (GATC) used in the BAC library construction.

>CH322-90E04 19711bp
GATCCATGCGATTCCACAAGTGTCTCTCGCTCTGCTCTTCTTTTTTCACG
CACTTTGTGAAGTGGTTAGATAATCCATTGTTTACGGGGGATGATCGGCC
AGAAGAACCGAACTGAGCTGAACTCGAACTCAAGTTGAAGGAGGCCCGAA
AACCGTTTGGTCATTTTGGCAGCGGGAAGATTTCGGAATCGATATTGAAA
TTCGTCTCACGTTTGTTTCTTGTAATTGCAGCCAACCTGGCAGACAGCCA
GGCATCTGGATTGGTCACGGAATGAGTGTTGCATTACTTGACCAATGAAG
CTACTGAAGTGGGAAATTAACCTTTGAAAGTTGTAATTTTACTGTATACC
TGTGCTTATGTAAAATGGATTTATTCAAAGAACAAATGGTTGGACAAAGT
TTTGGTTGAAAACATACCACCTAACAAAACCTTCCCTCAATCAATCAATC
CTCGAATGGCATTCCAATGTTTTCCACCACCCTTCTGCCAAAATGGATAG
ACTGCACTTGACGGAAAACTGGGTTGTTTACCCAACCACCGCCATTACCA
TTTCATCTTAATCTATCAACCACCTTTCAAAACCCGTGCACCATTCATAC
GAAACAGATCCATCGATCGCAAACGCGCAGAAGACTCTCTTCAGAAATCA
AAACTCAATGGTAGTTTCGACAATCGCATTGGGGCGTTTTAAGAATAACA
ACAATAACTAAGAAAGGAAAACGAGCAGCATTCGAGAAATGAAATCGAAT
CAAATGATGTGTATAAAATGAAAATAACACAAAGGTAAATACCAACAATA
ATAAAGTCGGTTGGGGAAAAATGCGCAACAAAAAGCATACAATAAAAACC
AAGAAAAATAACTACAAAAGCGCAAAGTATCCACAATGCTGTTCAGCTGA
GGGTGAGATGTTACTGTTGTGCACTGAGGGAAAATACTATGAATGAATAT
ACTATACTACTATGAATAGATATTACTATCGAAAATAATATTAAGTATAA
TATGTAACTTATTTTCTTAGCATGTAATTATATATTTAATATGCAAATGA
AATGGGTACATATTTTTTCCGAGTGCATCTGCTGCTGGTGCTGTTGTCCA
TGTTGCTGTTGCTATGTTGCCATGTTGCTGGCGGCGCTGCAGACAAGCAA
CATCGAGCGAAGACAACAACATGCGAGCGGAGGGACTGAGACTCTTAACC
TTTGACGCCCGAACAATGAAGTGGTTAAAAGCAAGACATTAACACACAGA
CACACAGGCGTCGACTGTAGGATAGCGAGGGAGCCGCGGGGACCACGGAC
TTGTAGCACTCGGAGTGGAATGACAGAAATTAGTGAAATTTATTATTGAT
ATCCACTTGAATTTATAGAGCAGCGAACAAAGCAGGCAACCCTCACCTTT
CCCCGTCTAAAAGGTGTATCTTTGTTGGCCTGGCGGTGGCGTTCCAAGCC
GTCTACCTATTTTTCAGCTGCTGCAGCTGAAATTGATGGGCGAGGAGCCG
AGTGGAACCAGTGGATATGGTTTTGGCCCGATCTAATGCGTGTGATAAAC
AGGTTCGCCTGGTAGGTGTCGCTTGGCCCATAAGTTATGGCCCAAAGACA
ATAAAATGCACACCGGGCAGCAGCGCTAATAGCCGATAGATACTTGACTC
ACCGCTGCGATCCCATCTGAACTGAACTGATCTGATCTGAGATGCGCTTT
CTATTCGTTACCAACTTGATTTGCCTTTATTGTTGTACTATATTGAGCCA
CCCAGAACAACCGCAGCAATATGAAATATCCAAGAGATCGTCAGCAGCCG
TTGAATTTCCGAGAAAACTTACGCACAACAATAGAGTTATTTAGGGCCGA
ACATTATTGATTTGAAATATCACACGAAATAACCAAAGTGCGCGTTGAAA
TAACAGGCCAGATCATCGCTGGCTTCTTGGCCACGAAACAGCTTGGGCCA
CTCGAAGAAAATATTTAATTCAGCTACTAGTTTCTAAAGAATAATCTACT
CTTTATATTTCACATTCATTTCATTTAGATGCCCTAAGGAATATATGATT
GATATACATTAGCTGAAATGTCATAGGCTTTGGATTTTTAGAGTAACTAT
ATTTTCTCACAGTGCATTTCCTTGAGCGGTAAAAAGCCGCCGAACGCCGA
ACACGCTCCACACTTGAGTTCTGACGGACTCGAGTGCTTGGGGAATGGAC
GAGACTCCACCTCAAGATTCAAGCCCCAAAACTCAAAACTCAAGACTCAA
GACCACAGACCCCCAGACCCCAGACCACAAGACACCCAAAGCCCCGAGAC
AGGGAGGAGCACTCTTGAGAGACCCTCGTGCTCGTGCCCCGTTTCAAATG
TTTCGTTAAAAAGAGGAATTGTGGAACCTTTAATTAAACGGTGGCCTAAA
ATATGCAAACGAGCCGGAGTCTTTGGAGATCGGAGAACGGAGAATGGAGA
CGTGGGGCCAGTCCGACTCATAACTCATTTCCGAGCAGCTGGCAAGCAGC
ACTTTGCATACTCAAGGCGCTGCTAAACGGATCACGCCCCACTTTCAACA
CAGATATGTGTATATCCAAGGATCAAAAATATATAAAAAAAAAAAGTTAA
GAAGAAAAGAGCACACGTCCTTCGGGCATTCGCTGATCTTTTTTCGGCAG
TCAGGTGGGAGGATCCATGCGGGCAGAGGCTACTGGAAAAAAAAGAGCCT
CAAAATTTGCATGGACCGTGAACATTTTGATTATGGTTTTGGTTTTGGTG
TTCGGTTTCTGGGCTCCCCGAAAGAAATCTCATTTAAAATCGATTTATGC
AGGAATTAAAATTCAGTTTAGCCGGGCAACCCTTTTCCTCCTCCAGCTAT
GCCCGTTTCCCATCCCCTTCGAACTGTCCATCAGCCGGATTCTCGGACTC
GGACTCGGACTCGGCCCCAGACTCGGCCTCGAAGTCTACGAAGTTGAGAA
ATTAGTAAAACTCATTTTGCATTTTTAGCCTCTGGGCTTAAACTTAATTC
GGAAGCACAGCAGGAGGTTCTAAGTAAATAAATGTGCCTCGAGTCGGCGG
AGTCTTGGAGAGCTGGAGTGCCCGGGGTCCTGTGTTGGTTCGTTTAATTT
GCATTTTATTGCTGGAAAAGAAGGAGACCCGACCAGGTCGCTGGAATTCT
GCGACTGCAGCCAATTAAGCGTATATTTGCCACGCTTTACAGCTTTCCGC
AACCATTGAGCTGCGTTCTCCATTCTTTCATGCTCTACTTTAGCCAACCA
GAGGAGATAAAAATGATTAAAAGCCTCCTCCAACAGCCAGACAGCGTTTT
ATATTAATTTGTGTATTATCTTCCAGGGACGCGCTGCCTTGAGAAATTGA
AAGTGAATGCTTTTTGGCGCTCGCATTCGAATAAAAGGCAGCAGGAAATG
AGTTGCCAATAGAACAATCACGGGTCACCATAGGGGGTGACGATTTGTTT
ATGGCCCAGGACTCTGGCCCACAAGAAGTCTGCCAGTTGCCTTAGCATAT
CCGGTAGGATTTTGCATTTGTTACCAAAGTAAAATTGAGAGTTTGAGATT
TCAAGGAAAAAAATTCAACATGGTTATAAACCCCTTTTAAGACGTCGAAG
TAATGGCGCTTTCACCCTAACCTTGCCCATCCATCTATGCAAGATGTGAA
CCCTGACTCACCCCAGTAACCACTCGCTTTTGACCCAATGCGAATGCGAA
ATTGAAATACATTTCTTTCTCACGTAGTCGCCTGTCATTAGCTCAATCAG
AGAAACGTTAAATCGCATCGCGCATCAATTTGGCCATTTGGGCCTTTGGA
AAACACAGAAACAGCCAGTCGACCATTTGGCAGGAGGGAATAAAGCGAGA
CAAGCGGTGACCGCGAACACGGAACGATGTTTCATGTTAGGGTTTGGGTT
TGGGTTCGGTTTCGGTATCAGACCATCAGGCACATGACTTCCTATATGTA
CAGTGAAGTCTCTACAAATGGATAGTAGCCGCAACTCAAGGGTGTTTTAA
TAGTTTCGAATTAACAGAATTTCTATCATAAAACGAGCGTAGTTTTAGCA
TCCTTCTTCTTCTCGACGCTTCACTGTGGAACCCATGCCCCACTCAGCGA
TGCAAGACGAAAAGGCTTCGGCCGTCACTCATTCAAGCCATTCATTCAGT
CACTCAATAATTCGGCAGTTGTACGTCTTTTACTACTTCTGGCCGCGAGA
AAATTGCAACAATTTGCCATTGTTGCAGTACGGTTTTTGCTCCGTTTGCT
GCAATTAATTGACAATCGGAGCCCCTCGATCCCAGATCTTCGACTTGAAC
CACACTCTCTTCGCAGTTTGAGCTCGAGTTTGAGTATTTGTGCATGCAAA
TTGTATTGAACTGATTCCCACGAACGTTTCGACTTGGCCAGATGGTTTCG
ATTTGATTGGACCAGTTCGTTCTTCGACCAGAAACTCGGTTTTGGATCGG
TTCCGATCGGATCTCCATCTCCAGAGGCATGCAAATCATTCGCGGAATGT
TTTTGGGGGGAAGAAACATTTCACATTCGCACTGTTCTCGGCTCGCAGTT
GGCATTGCACTGGATTGGGTGTGGGAATTCAAGTCGAGTGTGATGCATAA
TCACTTGGGACGTGGCCCAAAACAATTCGGAAATTGGCAACCATCGCAAA
AATTTCCAAGATATTGTGCGCTTCAATTTGCGAGTGGCGCCAGCGAAGAA
AAAGGGAAATTTATAGGATATAGTACTATAGTTTTTGTTTGATTTTAAAT
ACTTTAGTACCCCGTTAGCTGATGCATTATCACTCTTAATACGTCTTTTA
CCACCTCTTCTACCAACAAGCCGTATAAGCCGAACCCACATTGAAGAAGA
CCCTCCCAAATAATTATCCCAGTTTATTTCACATTCTTCCAATTTCTCGA
TTTTTGTACTTTCCCCTTCCAGCAACCGAAGAGAACCACACTTATTTGCA
GATGATCTTGGCCATGCGCCAACTCATTTGTTGTTTGCCCGCTCGAGAGA
ACTATGTCAATAAACGAAAAGATTTCAAGTACTCAAAACAACAAACACGA
TGGGTCTTGACCTACGGCAAAGATGAAAGGAAATATTAATATTCTCTAAT
CCATTGTAATTATGATTCCCGGCCATTGTTTGTCGCCGGCAACGTAACCT
TCGGATAAAAAGACAACAAACAGTTTGCAGCGAGGTCTTTTCAATAGATC
AAATTACCAAGTAGATATGTCAATTCCTCACGTAAAACGCGATAAGAGAT
CTGCGTCAAAACGGGGGATAGAAAGAAACCGAAATAGAAGTAGGAGAAGT
AAAAAGCAATAACCGACATCTAACCACAGAAATATCGACTACCGCCTGTC
TATTTTTTTCCCCAGAAAACCTGGCTCTAATCTCTGTCAGGGATTATAGT
TGGTCCAATCAGGGGCAACGCCTGCGGCTAATGAGCTGCCGTCTGTTCCA
GGGAATCCCAAAACGAAGAAATACTTTGGCTGAGACTGAGGCACCCAAAA
CGTACGCCCCCGATAATTACTGGGTTCCAATAAAAAAAAAGTCACTCCAA
AACAATAGGCCAGATGATCGGTGTTAAGCCGGTGATCTTGGCGATCTTAT
CGCCGCCCTAGATGTGTGTTATGACTTTTACTTTTCTTTGTCACGATCGT
GGTGTGTCGCTTCAAATCAAAGCAGTAGATTAATAATTCTGGCTCCCCAC
CCAGCCCTTCATATTTAGCCGTCGTTTGCGATCGGAAAGATGACAGAGTC
GGTGGAAAAATCAAAATCAAATTAAAAGACAGCAATCAATAATTTGACAC
GACTTGGGGCGATCGACAAAGGCCCGAAGACCACGAGGATCTTTACACGT
GCAAAAATAAAATGGGGTAACTGGAATTTGAAATAGTTTTGAATATGATT
AGGGAGAAAGCTGGAAAGCAGAAGAAGCAGAGATATGTGAAAATGGATGC
CTACCAGCTGAGGAAGGATTTTAGATATGTATTAGATACATAGGCTCTCT
TTAATTTTTGCAAGTGCATCCGGGATCGTTTGTCGGTGTCCCGTTGTTTC
AGCTGGGTCTTGAAGTGAACCTGGCTGTGATCTTGCAGCTCCGTGTAGAT
TTGTACGACTTTTGCGACATTTTGTATGGGGCGATGGATCGATCCGTACC
GATCTGCTCCTCCCTCCCCCATTTTTGCACTGTTCCGGATCCCGTCCCGC
TCCCATGTCGCCTGCTATGTACAACATCAAGTTTTATCGCTGATCGTGAT
CATGTAATTCCAGCCCACGCATGCGCACTCGGCGCTCGCTTCGAAGGAAT
CAAGTTTAGCGCATTCTTATTCGACTGAGACGCAGATGGAGCTGAAGATG
GAGTTGGAGTTGGAGATGGAGACTTCCACTTCGGCTCCGATGCGACTTCG
ACTGGAACTGGGACCTTGTGACAGATGGTTGTGAGGCTTCAAGGCATTCC
CTCGGATCGCCCCACCCAGCTCGGCCCAGGAAAGGAGCCGAAAGGAAGGG
CAAGGATAGGGCAGCCAGGAGCAGGAGGGACTGGTTTCTCCTTTACCCTT
GCACTTAAAAAAACATCTATGTATATGGGAAATTGTTCTTGAAACCTATC
TGTTCATAACTGGGGAGTTCTCTTCTAAAAGGATTCAGTTAACTAATCTT
TCGACACCATTGGGTTAATTATTTCTTAAGCTATTGATACAATTTTTTAT
TGAGTTTGAAAATCATTAAATACTTTTTTCACAGTGCAGCTAGCTTAAGC
CTGTGCGATCTTTATGTAAACTGGTACTTGAAATTTGAAATCATGTACCA
TTTGCCTTGAGACTGACAACGATACTTGGGATGGGTCTGGACACTGGGGA
TTGGGGACCTGCCAGTCGAAGTGGAAGTGGAGCCGGGCAATCGATGATCG
TGTCCCTGAAGAGGAGAACCTCCGATTGAGGCGGCACAGGAAACGAGCAT
TTAAAAGCGCGACTATCGAAATATAACGACATTAAGCCGAGGCTTTCATT
TAAAGGAAGCTTGTGTCAATACCACTGAGCTTGCCTTGGAATGCGCAATC
CCGATTGCAGATCTTTTGATGGCGCCGCCATTCAGGATGATCCAGGGATC
CAGCAATCTCCAGCAAGAGATCATCCTCGCGACGATCATCATCATCCGTA
AGCCGGCCACTAAGCGACATAATTGCTACCGTGGGACTGAGGATCTCTGG
TCTCCAGACTCCAGACTCCCGGATCATTAAATGCCGCGATCCTAATGCGC
TCCAATCAAACACACACGAAACGAGCGTATGACATGTTTGTGCATTATTA
ATCACGATAATATCTGTATAAATGGTAGAAAACTGAGAGTCCGGTCCAAA
TTGCAATTTAATGCAAAAATAAATTGCACTCGGTGCTGGACTGGCTCTTT
CCAGCAGTTTTTTCCTGCTTATTTCGTGGCCAACCAACCGGCAGCCGGAG
AGCTGGCAGCTCCCATGATTATTGGTCATTTACTTGGGCCGTTTAGCGCA
TTAAGTCCGAGTTCCCCCACTGGACACTCGCGTCTGGGGGCTTTGCATAA
AGAATAAGGAAATAATTGACAGTTGAAAAGTCTCAGCTATGATTGCGGCT
GTGATTCGAATTGTGATTGGGTTTGCTGTGCCAGCGTATTTTTGATTCTT
CTGGCAGCATTCTTCTCTCGCTCTTTCGTCTGCGATTCTGCGGCGATGAG
ATGGCGTGCGATGAGAATCATTTCAATCAACTGGCTGCGCTTGGGGCTGA
AGAAATCAACGCGTTGACTAATGGCCACAATTTGCAAGTGCTAGCAGGTT
GATGCACTCGGAAAAATCTCCACTATTGCAAATGGATTTTAAGTGTAATA
ATTTCCAGGAAACCATCTCAAGGTGTTTCAATCTGACCGCCAATCCAAAG
CCTTTTAAGATCGTTAATATTTAATAGATTAGACCATTGTTCCATATTCC
TTACTAGGAACTCCACGGTTTCCTTAGATGTCTAGAAAACATCTGGCTTG
TAATTCCTTATCAGGCGATCGCAATCCTTTTATGGCCGCCGATCACATTT
GATTTTAGTGAATTAAGGGATGTTCGCTTAAAGTTTTCTTCCCTCTATAC
AATGTTTTCTTGATATAGTAATAAATTATTCGTATGAATAACTTGTAAAA
ATAGCTATAATATGAGATTTCTTCTTATTGGCAAGTTCATAATGTAAGCT
GCATCTGTTACTTGTGCCTAAATCTATATTTAAAACCTTTAATTATCCGT
CAAAATTCTTCAGTTTCCAAGGTTAAAAGTACTTAGCAAAGCTTGCGAAA
TTTCCTAGAAAGAATCATAAACAACTACTTGCAAAAATTATATAAATAAA
CGAATATTATCAGACAAGAGGGAGCTGGCACGATGGGCGAGAAAGAGATG
GCACGACCAGGAGGGAAAGAGAGGGTGGGCAAAACACCCACTCAAAATCA
AAATCAAAATCAGGCATATTAACCACAGAAACCGGTTCTCTCTTTCTCAC
CTTGCACGCGCTCTCGCTCTACCTCTGATTTAAATGCGCGTGTGTGGGTG
AGAGCGGGAGTAAAGGTGCTCAGAATACACAGACAAAACGAGTTTGCACC
TGGCCAACCTGAATTTCTCCCGCTCTCCGCTCGCTCTTTTCGTGGGTGAT
CTTGTGGGCCACGCTCTCATCCGCTCTCGCAGGGAGCGATCGCCAATGGC
GAGAGAGATGTGGCGATCAACAAGTGAGCGCAGGTCCGCGATATGTCCGC
AGAGCAATGGACTTTTAGTTATTCCGTGATCTTTTACCAATATTGTGTGC
AGCGACGGCTGATCGACGTCAAGAGAAGAAGAAGAACTGGCAGAATCAGA
GAAAATAAACAATATTATATATACGTACATATATATATACATAGCTCAAC
ACGTGTATGTGTCTGTGTTGGCTAAGACCGGAAGTTGCATTAAACGGAAG
TTAACTAATAGTAACTGCACATAATTTTAAAGATCGATTGTACCCAAATT
GTTCGCGTGTGCTAGCCAGAAGAACTACCATATTATTTCAGTCGAAAAAA
TCGAAAAAGCGTGCCTGCCAATTTGACTTAACTTGGCTGAGACTGCACTT
TGTTGTTTTCGTTTTTGGCCAGACGTCAAATTCGATTTTTATGACTTTTG
AAAGCGTGACTAAGACGTGATTTATGATGGCGTGTGGTTTTTAATATTCA
TGTGGACGCGCTCCGAACCTCTCAACCTGCGTAGGTGCGCCAAACAATAA
AAAATACAAAAAATCACCACGGCAACCAGCAACACAGCAACATCGCTGGC
CCGAGGCTTTATCCCGATATCCAGCTGAGTGTGTGCGTGGATTCGACTTT
TTTATGGAGGCAGTTAAGCATTTGAGTGCCGCTGCTGCTGCTGCAGCTGC
AGCTGCAACTTGCAGCGATTCGCCGGCCAAGGCAGCAGCCTCACCGGCAG
CAAGCAGCGATATTGCCGAGGCGCTTGGAGAACTCAAGGCAAGCGCAACA
GCAGCAGCATCATCAGCTAGCAAGGCAGCAACATCGAAGCACCACAGCAA
CAACAACCACAAGCCAAGTGCCGCAGCAACAGCCACAGCAGCGCACAAGA
AAAGCGAGAGTTGCAACAGCAACGGCAACAAGTGCACCGCTGCAACATCG
CCGATCGGCAGTAAGACCAGCAACGCAGCCATGGCAGCTGCAACAGCAAC
GGCGGCCGCAGCAACCAACGATCTTGCAGCGGCTGCTGCGGTCGTTCTTT
CGCTGCAAGGAACCATGGTCAGCAGTTTGCAGCAGGCCGCCCTACTGCCG
GCCAATTCGGCGGCAGCAGCAGCTCTTAATCTCCAGGCCCTGGAATCCTA
TTTGGCGCTGCAGCGACTAACCGGGAAATCGGATGTATTTCGCTTTTCCA
ACAGCAACACCGGCAGCAGCAACAGCAACAACGCCACCACCTGCAACAGC
AGCAGCAGTGAAGCGGACAACAATGCCTTACCCTCGCTCATCGATATAGC
CAATATAGAGCTCAAGTCGAGCTGCTCCTCCAGCTCCTCGGGGGAACCCC
CTTTGACGGCAGCGACAGCATCAGCTGCCGCCACATCCTCGCCCAGCAGC
AACAACAGCAACTCCACCAGCACACCAACAACATCCAAGTGCGTGCCTCT
GCCCTCCATTGGCACCGTTAGTGCTGCAGTGGCGGCTGCTGCGGCTGCCG
CAGCAGCTGCTGCGAGCCAACAGGCGGCGCTGGACTGCGCAACAGCCGCA
GAACTGGCAGCAGAGTGCGACTTACCGTTGCTCGATGGCGAGGATGCTCT
CTCCTTCGAGGCGGGAGATTTGGACAGCAGCTATGGAAGCTTCATGTTTA
ATCCCTCAGCCTTCAGCCAGGCGGAAACGGACTCGGCTCTGCACTCGCTG
CAGGCCACCATGTACCAGGACAAGATGAGTGTCATTTCGGGAGCGGCTGG
CGGCGTAGGTGCAGGTGCGGTAGGAGGGCTGGAGGAGGCGGGCAGCTCGG
CGGCGGCAGCGGCAGCCCAGCGGTCCAAGAAGCAGTTCATATGCAAATTC
TGCAACCGACAGTTCACCAAGTCCTACAATCTGCTCATCCACGAAAGAAC
GCACACGGACGAGAGGCCTTACTCCTGCGACATCTGCGGCAAGGCCTTCA
GGAGGCAGGATCATCTGAGGGATCATAGGTAGGTCAAAAATAGCGGATAA
GCTACTTCATGGTATAATAAGAAATGATCCTTCTCTTGAGAATCACTCTG
TCACAAAAGACTAGCATTTGGTTTCCATAAAAATCTAACCCACCATTCTC
CTCATTCATTTTGGTAACCCGCAGATATATCCACTCCAAGGAGAAGCCCT
TCAAGTGCGCGGAGTGCGGCAAGGGATTCTGTCAGTCCCGCACTCTGGCT
GTCCACAAGATCCTGCACATGGAGGAGTCGCCGCACAAGTGCCCCGTGTG
CAATCGCTCCTTCAACCAGCGTTCCAATCTGAAGACCCACCTGCTCACCC
ACACCGACATCAAGCCGTACAACTGCGCCTCCTGCGGGAAAGTCTTCCGG
CGGAACTGCGACTTGCGACGTCACAGCCTGACGCATAACTTGTCCGCCGG
AGTGGGCGGTGTGGTGGGTGGCAACCTAAGTGATCCATTTGGCTCCGGCT
CCAGCTCCAGCTCGGAGTTGGGCTTGCCCACGGGCTCCGCCAGTACTGCA
GCATCCTCCAGAGATTTGGTGGCCGTCAGCGATTGATCTTCCTCAGCTGA
TTCCTCACTCTTTGATACCCACTCAATAAAATAAAATCTCAATTGCAGCT
CTCATGAATACGAATCCCTCCATTTCGTAATCGTAATCTTAGTACGACTA
AACAGCATTTAGTTTAGTGTAAGTTTAGCCTTAGCTACTTTGGTTTAAGC
CTTGGATATTTGTGACGTAAGCATAGCAGGAAAGTTTGACTTTGCGTAAA
TTAACGTTAGATATTAAGTTAAATTGTGGACTCTTAATGTACGATCGAAT
AAAAGACAATAGCTTAAAGGAAATTGTGCACATGGCTTTTTATTGTTGAC
TTGGGCTTATGGTTATAGAAAGGTTTTCTTGAGACTAAAAAGAACGTTAG
TTGTATTATAATTTGAATATTCTAGAATTTTACCACGGGTATGGAGTTTG
AGTTGTTTGAGTTTCCAAAGGCCTGTTGTTCATTTCAAAATTCAAGAATT
TTCCAAAACGTTTTTCTCACCCTTTCTACCTTTCTACCGCTTTGATTCCA
CTCTTGTACTTACACTATTTACGCACTTGTAGCGAACTAAAATCAAATAT
TTGTACCGATGTTTATCGCTCGAGTGCCAACAAGGGCAATTAATGTAGCA
TTAAGGTGCACACCTTCAAACACCTCTTTCAACAAGCCTTTGACAACAAA
CAAAACAAGATCGACAATAGTGGGGCTAAAACAAAGAAATGCCCATATTT
TCCCACCACTTCCAGGCTGTTCCACATTTCCAGTCAAATAATGTCGTACA
AGCCGGTGGACAAGTGGAGCAGGCGCTATCTCATCGGGTCGAAAGGACCA
CCCACTAGAGTGTGATATATAGATATCGGGGCACCCCATTTCCCACACAA
GAACATCCAGATAATTCCGGGCGTGTCCGCTGAAAGAGCTCGAAAGAGAT
TTTATAGCGAAAAGTGGGCTGTCCATTCCAGAACGAGGGTGGAGCTCCAG
CTCCAGACTGCCACAAAGTTTACAATTTTTATTATCGACTACAAAAAGAT
GCGGCCATAACGACACAAACACATACAGTGCAGTTCAAAAGCGAATGCCG
ACCGCGTTTCCTTCCACGGCCATCTCACCCCTTTAGCTTACTTTTATTTT
CTTTCCTTAACTCTGACTCTGACTTCCCGAAAAGATCGGCGCGTTTGTCA
ATCGTTAAACGGATCAATGTAAAGCCGCCTGCAATGTTGTCTTTATGGGG
CCTCCACTGTTGCTGTTGCATTTCCTGTGCTTCAGCTGCACCAAACCCAA
ACCAAACCAATTACAACGATCAAACAACAATTATGGATGAGTCCGAGCTC
TGCGTCCCAGTTTGGGTCCCATTCTTGACCAGATCCCGCGGCTCTGTGCC
GGCTTGTTTGCCGTGGCCAGCCGGCTGCTCAGCCCCACCTCCACTCAGCC
TCCTCCTCGGGTGGTTAAACATTTTAAACACGACCTGCTTGCTGCTCTCT
GCAAATATTTGCGCGGATATTGTTCTATTCAATGGAACAAGCGTGCAAGC
GACACTGAGAAAAATAATGACAAAATATTTGAAGCAATTATATTTTAAAA
ACAAGCATCCAAAATATCGTACTGGTATTATTCATATATTGCGGCAGTTT
TCAATGAAACTATCGTCTGTTTCTGGTTGTGTCTGCACTACCTTTTTGTA
CGAGCTTAGTGTCAACTATTTCTCTGAGTGCACTGGCATCTCCCATTAGT
CCAGGCTCTAAACAGCCTCCAAAGACTGAGAAACGCCGAGAATGGAGCGT
CTCTGCGAATTGCCAGCAATTTCACACTTTATGCGCGACGGCTTCATTTC
CACAGAGTGCCTACCCTCACCACGACCCCCTTGGGAGTACCCTAGAGCCC
CAGGCTATGTCGTAGTATCCAGCTCATCCTCCGGCCAAGAGTGGAGCATT
CTTTCCGAGCGGCGCGTGCGGGAAGAGCGGATGTTTGAACGCTTTCGAAG
TTTACGAACGCTCCAACGTCGCTCCAACCGGCTGTTGGACCGTATTGATG
GGAAAATTATGAAATTCATTGTTTGTGTTTGACTAATAATTATGACAGCA
AACGCATTGTCGTCATAAACGCGAGGGGACAACCCCGAAACGAGGTGGTG
GAGTGATGCGGAAGGGGCGGGAGCGCACTAAATTCGCTTTGAGGTTTCCG
CACCGCCCCAGACAAAAAAAAAAAAAGAGAAATGAAAGAGGAAACAACTC
TGACTAACTCTAATAAGCCCATCAACGGCAAACGACAACGCGGCAACATT
CCACCTTCGATCTGCAACACTTACAGTAAAAACGACAACGCCAAAGCAAC
ATTACACGTAAGAAAATTCGGTAGAAGTATAAATAAGACAACACGAATAA
ATATAACTTTAAAACAGAAGTTCTAAAGAAATTTCAAAAGTTTCTGAGTA
TTTTCTAGATCGAATCTACTATAATCAATGGTTTGTAAATGCAAGAAATA
ATCCTAATTACAAACTATTAGTATTTCTTTCGGTGCACCAACAACACCAA
CCAACAATGTTGTTGTCTAGTGTTCGAGGCGTGGCCGTTGGAAGATTCTT
TGAAGTTGGCTATTGCTTTTGGTCAAGGTGTTGTTGTGTTCATGCGGCTT
TGGCGATGGAGCGGGGGCACGATGATGATGGGGCCAATGATGATGGCCAA
GTCGAGAAGAAGGGAAACATTTTTGGTGCGTTGTGAAATTTTGTTGCGTT
TCCCGGAACCAACGCAAAAAAGCGGAACGTTCTCGTTGTCGTCGGTTGTT
CGACTCCTCTGGCTCGGTTGTTTGGTTGTTTGGCCATCGGTATCGGTTGT
TCATTTGCCCTGGCGTTGTCTTTTTGGGGCGAATGTAAATGTCAGTGGGC
TGTCGGCCGGGCTATTTGGTTATTTGGCCACTCTGCCATTTTGGCTCCGG
CCAGTTAGTTTGTCGGCACCATTTGCTTTATGATTTGATGTATGTGGCTG
TCCGTCCGGTCGTAACTACGCCAATAATTCTGACCCGGCCGCATCGGCAC
CTCAATGGGAACGAATCCGTGTTTGCTCAGTGCTGAAATACGCGCCAGCC
ACGCACTGAACTCAATTTTGCAGAGTTTCAAATACTCCACGGAAATGCTA
TCTTAAAGGTATTTGTTCTATATGATTATTTCAATCTTTAATTTGTTATT
TATTATTTTTTTCTGTGTAGGAAAAGCCTTGCTTACTCTTTTTTGGGCCA
ATCGCTGGCGTTCGAAAAGTCTTAAGTATAGTTTCTTGCAGTTTGCTGAG
TTGAAAGTTGTGCCAGAACTGAAGGAAACGTAAATTTCTGGCGGCGTTCT
TCTGCCTAATTAGGTGCCATCTCGTAAACGTTTTCGCATTTCTGTTGGGG
CACTTTACGTGGCGTTCAGTAAGTTTTTTCTATCTTACACTAAGGTATGC
GGTGGTTGAAGTACCCAAGCTTTTCAAGATTACCCACAAAAAACTTTTAG
AAATATGCTACATAAACTTATATGCTCAATATGAAAATTAAAAGATTCCT
ATTTCCAAAGACACCTTTTGTACCGAATAGTTGTTTTTGTGAATTCCCCG
AATTCTTTTCGTAATCCTACCCCCAAATGCCCCAACTATGAGCATTTTCA
TACACAAATGAAATGGCAGCTGTCTCCTAGACACCTTGTCTCCCCATTCC
CCACCCCCTGCGCACACCAGCCAACCGTAAAGGCCCTTTGACGACCGACA
AACGATCATAAAGTCAGGAAAACTAAATTTCTGGAACTGCAGTCGCCGCC
GCATCTTTGTGCCAATGTCATAATACAGAAGAAGAAAAGCTGCCGAAAAT
CGTGCAAGTGAATAGAGAGACCTTGCTTATAAGGTCCGCAGTTGTTGGGC
CCTTGGTGGCATAGAACTCCTCCGACGATAGGAGAAGTGGTGGAGGGAGG
GCCCAAACGGTGTCCCCAAGTGGTTATTAGATTTTATTGGACGGGACACT
TTTGCCGACGGGGAGTTGGGGCCATTCCACAGAGCTCAACGCTTCTACAG
AGTTCTCTCACGTTGCGGCAGAGAACTGAAGCATGCATATGAAGTCCCAC
TCGTAGGGCAATGCACCGGAAAAAAAACAAGTGTCATTTGAAGCTATGAA
AAATAAAATCGATCACATACAGTAAATTTTCACAGTTGCTAATGCCTCGG
TATGGGCACCAATAGACCAGAGTAATATTACGTTTTTTGATACTTTCTGA
GATTAATTTCCCACCCATATTTTTCGGTGTATTCCCATATGCCAGAACAT
ATAACTCTTGCGCGATGTCGGTTGTTGGATTTTATTGCAGGCAGGCGCAA
ATGCAAACAAATGCGACAAATGTCGAGTGTGCACACATATTTAGAGTTGT
AATTGACAGTCGGACGAGTGCAGCGAGGTGGTCTCCTCTCTTTGGAGTCC
GGCACAGGGCTCCACGCTCCGCACTCTCCGTAATCCGTACTCCGTACTGC
TGCCCGGCACTCCGTGCTCCCCGGCTGGCACTGCGTATTTGCCCACGGCT
TGTTTGACAACTTGCCGGGCACGTAGCACGGAGCAGTCGATGGATCGACT
TGTGTACTACAACATCCACAAACGTCAAACAATGACGGAAACAGCCACAC
AACTGGAGTGTACACTGAAAGAAATGGCTTTGATTTGCTCCGTATAGTTG
CTAAGCAATCATAAGAAAGGGATCATAAACTATCTTAGGCTACAGGATCT
TAGGATGACAGAAAGTTTATTCTTATTGCTTCAAAACTAAAGCAAAGTAA
TACGTATAATGCGAATTGTATTCTCTTAAAAAGGAAACATCTCTCAAATT
ATCGAGTATAAAATAATCTTCTAATTGGCCCCATTTCCGTTCAGTGCAGT
GGATACCCACCTCGCTGAGAGCGAGAGAGCCGTGCAGATAGTGGTCGAGC
TTATCTCCCCTCGCCGCCCACCGCCCACCGACCTGAGCACCCCTCCTGAG
CCACTGCAGCACCCCCCTCGCCATCCCTGGACAAACACTTTTAGGGGGGT
TATATGACTTTTCGGAAACTGATAAGCTACGCTGAGCTGCAAGCTAATTG
AGTGACGACTACGAGTACGCGGTTAAATTAAAACGAATCATTTGCAAGCA
CACCCCTGAGATCCGAAAAGCCCCTTCACGCCCTCTGCCCCACCACCGCT
GAACACAGCCACCCCCACCTTTACTATTATTTTTGTTTTTTTTTTTTTAC
CACGACTACTTCGTCGGCAGTCGACGATGATTAGAACCAAAACAATCAAA
CAAAACACATCAAAGAGCCGGTGCCGTCAATTTGTCATTAACGTAATATA
CTGACAAGATTGCTTTGCACGGATATCGCGGACGTTAGTTGACTGTCGTT
ATATGTAAGCCCCATACTATAGCATTCCATACTATACCATAGCATAGCAT
ACCATACCATGCCGAACCATACCCCTTAGTATTTGTCAACAAACACTGAG
TTTAGCGTCCGTCAAGGTGTTGTAATACTGTTATGGTCGGCTATTTTGAG
AGTCTCTATTAGTGGGGGCCAGTTGTAAATTTCCGTTTTTAGAGTGAAAA
AAATAATGTGACATATTTTTGTCGTTTAGGGTTTAAGTAACGTGGCTGAG
ATCTTGTTTGCCCAAGGATTAGCAATTTGTGTGGGATTTTTCTAAGTCAT
GAGTGCTTCGAGTGGAACTGCAGTGGGGAAATGAATGTTTGGTGAGTGAT
TAATGCGTCATAAGTGCTGATTTTGAATGGATGGTTTCCTGTAGAAAGTA
TTTGAACTGTAAAACACATCTTTTTTTCTTGCCGCAAGCATCGTAAATCC
GAGTAGAACATTCACTGAACCATTGACACCCATACATTTAACTCCTTCAC
TCTTTTCTAAGCCGACAGTTGTGACATGATGGCGCTCACTTTATGGTTAA
TTTGGTTGAGTCCCTGTTCGACGATTACGACACCTAATCACAAAGTAAGC
TTCAGATGAACAGCTATGTATATGAAAAGAGAATTATGGTGAAGAGCCCG
AGGCCACACTCCATACCCCTTTTCATTTCAACATCAGACAGAGTAAAAAT
GAAGTCTAAGCCGATGCAGACGGCAGATAATCTGACGCAGAGATACATTT
AGAGTCGGAGATACTTTCTATCTTATAACTTTACATATAACGTTATATCC
TACAGTTGCTGAATGTGTAGAAAAAGGGATGGTATAATATATATAATATC
ATATCATATCCTTAAAACCCAACAGATGCAGCAGACAGGCGACCAGTCGA
CTCAATTATGGTTACGTAAGCCGTTTTGCGTTCAAAGATCAACGAAGCAT
ATAACCAAATATATAACCCGGATTCCGGATTCCGAAGTCTGGTACCGGTA
ACCCCGACAACCGTTTTCGGTTCCCTTCGGGCTGCCGTTGACAGTTTACG
GGGCACTTTAAAGTGCCCATCTCCAGTGGACACCTATATAAATTTCACGC
TTATCAGCATTCCCTTTCAAAATGAAAGGGGACAAATTGCTTCCCCCGTT
TCAACGGCTATATATCCTGTTCCTATTGTTGCTTTTGCTGTTGATTAGCT
TAATAATTTGTACCCACTTCGCACCCCATTTCCACAATTTCCCTTCCGAC
GAAACGGGGGATGTTTGATGAACTGCTGATGGGCGTGGCATGGTGTAGAT
TACCAGCGAAACAGTTGCTACTAATGGATGGTTATGGTTAGAACCGGGGT
GGATTGCTCTTGGCTCGTCCATCCGGGATGTTTTTTTGCCCGGCCACCAT
GCTGGGATAATTGAATAAACATTGAGGCGGGCCGGGCAGCGTTAATGCTT
GAAGTTTGCCAGGTTTTTCATCCAGTTACCAGTTAAAGTGATACCCATCG
CAGCTTTTATCTTCTGTAGCCAACGGGGGCGTCGCAACCTGATTTCAATC
ATGACTCGGGCAGTGTTTTGCATATCTAAAATCGAAATCTTGGCTGACTT
TTGGGGGAGGTGACCTTTGAATAATGAAGACTCTGCAGAGAATCTTTTGA
TCTAGATGGGATAATCGAGTCGTTACGAGGTATTCAATTTGCAAAGGGAA
TGTTGGCATTGTTTAAGGAGTGATCTAAGACTTTTAACTAAAAACTCATG
CTAGTAAAAATGATCGTAATTAATTTGTTAGACTTCCATGGACGACTAAG
AATGAAGAAGAGAAGCGTGAAATATTTTGTTTTCCACCTGGGACACCTCT
TGCAACCAAAGCTTCTGATTCTGAACCCGATTTCTCGATCTCTCTCTGAT
TGATGATCCCAACACGCGACTTCTTTGTACTAATAAATTCCCAGCAAAAT
TCAGACAAAATTCCAGGCCCCAGAGATAAGGTCACCAAACAGCAGAGACA
CAAAATGAATCCGAATCGGAGTCCAAAGTGTGGAGAAGAGCGATCATCAA
TGGATCGGGCTGAGCGGCTCTTCCGGTTGGACATTGGGACATTTGACATT
GACAGTTGCAGCCATAAATAAACGTACAATAATTCTGTAGCCCTTTGTTT
GAGTGTAAACAAATTAGAAATCACACGACCACAACACAAAAAAAAATTGA
CCACACTTGGCGAGTGTGTGAGCTGTGTTTACTTAACCACTGATAACAAA
GTTGAAACAATAAACATTTTTCTCGCACAACAAAACACACAAATCCACTT
AGCCACGCGCGTAGAAAGAAAGCCACCGATGAGAAGAAAGAGCCGGACCA
CCGGGGCCAACAGAAGAAGAAACCAAAAACAGAAGACTTAAGACAGCAGA
TCGACCCAACTCGAGAAGAATGCCACATGACCGTGCAGTGGTTGCGTTGG
TGGTTCCACTGGCGTCACATAACCCATGCGAAACAGACGGCAATTTATTG
ATGAGTTTATTGCAACCACTTGAGTGGATCGGGAAGAATCCGGGGGGAAG
ACTGCAGAATGATGCTCGATGATGTCTATGTCGTCGCATCGGCATCATCA
TCAGTTGATTCTTTGTATGATTTCTTCGTTTTTTTTTTTTTCGACTGCGG
GGGGACACAATTTGTAAATTTCGTTTTATGACAACGCGCGCCACGTAAAA
TAAAACCATCTGCGGTGGCTTCGTGTGTCTCCGCTGACAAGCGTCCCTGC
ACTTGGAGAAAAGTCTACTGAAAACATCTAAGTGGCTTGTGAATTTACAA
AGACTAATTCTAGTGTTCAATTAAGTGTCTAAAGTCTACTAATATCACTT
GAATGATGCTATAACTAATATTTTAAATATAGCAACATACCATATGTGTA
TTTAGAATGGTTCCGCTTAAAAACAGAAGAATATGCTTTCATTTTAAATT
AATCCTAACACTTATATTTCCAGTTTTAATCGCAGTGCAATCCAAACTTG
AACCAAAGCCACGAGAAGATGGAAACAAAAATGCTAATTTAAAAAATTAT
GAGTTTCGTTCGCTTTTGGTCACACCTTAAAAATGCTAACTTGATTTCAG
CTGAGCTGATC