P[acman] BAC CH322-59M17

CH322-59M17 is on chromosome arm chr3L from 878384 to 897490.

BACPAC Resources is the distributor of clones for this project. Investigators requesting a clone will need to establish an account with them. They will also respond to all questions regarding shipment and availability.

Return to the Browser

The sequence for the BAC is deduced by extracting the sequence from the reference genome between the alignments of the BAC end sequence. The sequence of the BAC has not been confirmed over its full length, nor has the sequence been aligned to the MboI restriction sites (GATC) used in the BAC library construction.

>CH322-59M17 19107bp
ATCCTCTTAAGCTCCGCACTGCCCCCTGTAAATTCACTTCTCTCTCCTTT
CCAACCGATCGAAGTCTCCTTAGAGCTTCGATTCGCTTGTCTTCTGGGGG
AACTGCGGATGTCCCTCTTCCTGTTGCGGACTCGCCAGTGTCTTGATGAT
CTTGGGCACTATGGTGATCGGCTGATCCTCGTCGTCCTCGGCATCTTCGC
CCTGCTCCTCGTCGATGGGTGTGAGCGTTTCCACATGCACAGGAGTCTCC
TCCGAGGGACTGCATCTCTTCAAGCAGGGCGCCAGGAAACTGGTTATCGT
GGAGATGCCGAACAACGCACCGGCCATGTAAAAGGGCAGGTCGTAGGTGT
GCGTCATGTCGTAGATGGCTCCCGCCAAGGGCGTTCCGATCAGGGCGGCA
AATCCTCTGAACAGGATCAGCAGTCCGAAGGCATTTGTTAGCTTGTCCAG
GCCGAGGAGGTCGACCAGGATAATTGACGTCAGCGAGATGTAGCCCGAGA
TGGCCAGTCCGAAGAATATGGACATGGTTATGTAGGCCGCGTAGCTGTAG
CACAATGGGGTCAAAGTCACGGCTATGGTGGACACCAGCAGGCAGCAGTT
GTTGAGCAGTAGCGAGTTCACTTGCGGCAGGTCCGCTACCCAGCCGCAGA
AGACACGGCCCACGGTGTTGGTGATGCCAATGATGGACAGAAGCATGGCT
GCATCGTTCTTTGGTATGTCGTGTTCCTTGGCCGCATCCACCAGGTAGAC
GAAGGGCACGTACAGTCCGGCCATGCCAAAAATATTCGAGACTCCGATAA
GCATGAAGACGGGATCCTTCAGAAGGCTAACATCCAACATGGTGTTAACC
ACGGACTTCACGGAATCGGGAATGCCAAGGCAGGGACACAGGTCATACTC
CTCGCGATGCTTCTCAGCCTCGGCCAAGGGATCCAATTTAGCCACACTCT
GCATGCTCTTCTCGTACTTGGTTAGCGACAGCACCGAATTCCTGTAGTTG
GCCAAGGACTTCTGGGACTGATATTGCGGCAGGTTCGTCACGGATCCCGA
GTAGAAGATATCCTTGCGGGACATGGGTCGCACCATCCTGCCGCTGCTTC
CAGTTTGACTGCCGCCCTGCCGTTGTGAAAGCGACAACTTCGAGGAGGCG
AAGTCACCGCCTGCTCCTGCCTCCAAATCTCCGCGAGAAGTGGCCCTGAT
GGCGGCCAGCGAAGGCTGGAAGCGCTCCGAGGCGGAGGTTTTCCTAACTC
GCGTGTTGAATGCCGGCACGGATCCGTTTTTGGGCAAACTCTGATGATCT
CCGGCCAGGAAGGCGGGCTGCGATGCGTTCCGGGTCATGGCATCCTGCGA
GTGGTACGGACTATTCTCCGACTCCGAGTTCCTGTGAGGACGGCGGCCGA
CGGCACCTGCGGCGGATCGAGCGGATAACTGGCCATTGCTGTCGCCATTT
GGTGGAGATTGCGCGCCGTTCTGTCGATGAACATCCACCACTTTGGACTC
CGTGATGGTGGGCAGGGTAGAGACGGGATGCAGACCTCCGCCGCCTGCCT
GTTGGGCCAGCAGCTCCAGATTCAAGCTGGAATGCACACCGGGATCCGCA
TTGAGCGGCATCTTCAGTTTCCGCTCGATGGTTCCATCCGGTAACTGCAC
CATGAAGTGGGAGCCCGCAAAGGAACCCCTTTCCAGCTGCAGCTGCTTCT
CCTCGTACATCCTTTGCATCAAGGGCTTCTGCTTCTTCTTTTTCGGGTAG
GTCAGTGGCCGCATCATGGCTCCGAAGATGGCGCAGTTGAGGATCAGGCC
AGCAAAGATGAGCAGGGCGTTTTTCCAGCCGTACTCCTCCAGGAGATAGG
TGGCCAGCGGGGCAAAGGCGAAGGTGCCAAAGCCAGAGCCGCAGACCGCA
ATTCCTGTGGCCAGACTCCGCTTGGTTTCAAAGTAATAGCCCACGGCCAC
TACAGCAGGCAGATAAATCATGCCGAACCCGAATCCCCCCATGAAGCCAT
AGGTGGCCATCAGCATGCTCACGTTGGTACTGAACGTACTCAAGACGAAG
GCTATGCAGGCGATTATGCTCCCGGCTATGCAGACGGCTCGGCATCCGTA
CTTGTTGGCCAGGGCGGAAACGATAGGTCCGGCGCTGAGGTAGACTCCTG
ACAGAAGACTGCCCACCCAGGCCACCGTACCCTTGCCCTCGTGGAAGTAG
GCCACGAACTCCTCCAGGAAGATGCCGAACGTGTAGGCGATACCGTCCAC
GATCATGTTGCACATGAAGCTGGCGAAGCAGATGACCCAGCCGTATCCTC
CGTCCGGCGGAGGCGGCAGTTCCCCGTACACGCTCTCCTCGTCGTCGTCA
TCCTCGTCGTTGTCCTGATTGTCCTCGTCCTCCGGACTCTGTTCCGCCGT
CAGCCTGGCCGCCTCCTCGCAGGCCAGCTCACTGTCCGTCCGCTCGAATC
TCCTCAGCCTGGCGGACGAGGCGGAGTTTCCACCCACGATTCCCGGATTT
GAACTGTTTGTATCCACCATGTTGGCGGGACGAAGGGTTAGGGTTCCCGG
GCACACACGCGGTTTTGGTGGAGTTGAAAAAGTGGGCTAGAAAGTGTGAA
GTGCGAAGGGCGAAGAAGGAGGAGGAACGTCCGCTTGGCGTCGCTGCCCG
CGTGTGAATGCCAAATGCGAAGGAGAGAGCCCAAGTTTATCTCTTCACTC
TCGCTCTTTGCAAGCTCGCTCTTCGCTGCTCTCCCACTGCAGTTGGCTTT
TGTGTGAGTGTGTGTCAATTGTTATTGAGTTTTTGTTTTCGTTTAGTTTG
ATAAATTCATAAATTCACTAGCGATAAAAGGCGTGGGCTGCCTGTATTTA
AGCAAATATTAGACGAGTGCTGCCTTTGGCCTGGTTTATTAATATTTTAG
CTCCAGTTGAACAGTTTGACTTTATTTTGTGCTGGTTTCAACTTAACCGT
TACTATTTTCCTTGCGGTTTTTGTGCTTTATTTTCGCTTATTTCCGCTTT
GTTTGTGTATTTTTAACTTGCACTTGCAGCTGCAGCTGAGGTCACTAGAA
AATGTTTGTTTTCCTTAAATTTGCCCGATTTTCGCTGGTTCTTTGCTTTG
ATTTTTCTTTGACTTTGATTTTGCGTTTCTGTGATTTCCTCAGCTTTTTT
GGGGGTGCTGTACGTACGTACGTACGTGTGTACGTCGTAATTTGCGAATG
CAATTGTATAATTTTTCGATTTTCAGCTTTGAAATTCGATTGGAGAGCGT
GACAGAGTGTCTGAGTTGGTATGGGGTGGGGAGGTGAGGTGGAAAGGAGG
AGGAAGAAGAGCGGAGTGTGATCGATAAAAAGCGCACACCACGCACACAC
TCGGCGGCACACACACACTACTCGATAACTTTTAGCTGCAGTTGCATTTG
GGCGACATTTTCATTTGCTTTTTGCGAATCTGGCGAAAAATAACAATCTC
CGATTCCGATTTTGAATTCCCCGAGTTTTGTTCTGAACTGCTGCGCCGTC
CGCTGCGAAATGAAAATGAAAATTCCTCGTAACGGCAGCAAATAGCGACT
GTTATACGATATACAAAGACAAATTCTAAGTTTCTGTAAAAACACTCGCC
CTCTCTCCTTCGCTCTGTCGCCCGTTTTGTTGCATTTGAAGTTCAAGCTC
ACAGAGCGCAAGCTCCACTCGCGCTCTCTCGTCCCCAAAAAACAGCTGAT
TGAAACAAAAACAAATAGCCGCGAGAGCGGGAGAGTGGCAGTGATAGGGA
GAGCCAAGACAAACAACCCCTCTTTGTTTGCCCAAGGGTTGTCTTTTTGT
CTTTCTCCCTTCTTTTTATCATCTTTGCTTTTCTTTGATTTGAATTTGAA
AAGGTAAAGCCTGAAAAACCGGTAACCGCCTTTTGCCACATGGCCACAGC
AATTGTTCAAACTGTTATACTGCACAACGTTCCTAAACCAAAGAGCGCAG
AAACTGTTGCTCTTTACTGCCGATTTAGGTTAAAGGTTAACTTTTACTTT
TCAGAAGCTACGCAAAATTTTGCAGGACATCTTACACGGAAATTACATTT
TCTTAAAGACACTTTTAAAGATTTTGAACATACGGATGTTTTTCCTACTC
TTGTAGCGAATGTGTAACAAATGCACTGCTAAATGCTTTTTCAAAATATC
AAGGCAAATCACTTCCATAGAGTAGATATTTATATTTTATATTTTATATT
TATATTTTATATTTTTAATTATTTTTAATAATAACAGTGCAACTCCCAAA
CTGTAAGTTTCATTTAGGGAAGTTCTACTGTCATTCTAAGTGCGTGTTCG
GGCGAAAGTGTTACTTTTGTCTGCCGCCTTTTAGGCGCCGACCATTGTAT
AATCCGCGCATTATCTTTACAGTTGGCTCGCCTAAATAATAAAATGCATT
CGACACGCAGCTGATAAGAAGGCCTTTTGAGATATTTCTAGTTATTTTGT
TTATCAACTTTTTCGTCTGTTGCCAGGTCGTAAAATCGTAAAAATGTGCT
TTTTGTCTTCTGGTTGTTTATAACAGTTTTTCGGCTTGGTTAGCACTTTT
TCGTCGTATTTGTTGCGGTGAGGCGTCGTAAGAGAATTCTTTCGTTCTCT
TTGGCTCTCTCTTTCCTTCGGGGGGATGTGAGCAGTTCTTCTTCTTCTTG
GGTGGTTGGTCAATGTCATTCATAAAAATTCCATGTCAAACACACGCTCA
CATGGAAGGAAAATGAAACCCCTCCGATATTGTGGGTCAACGCCAGAGGG
CGCCACTTTGGCTCTTCCCACGATTCTTTCATGTTATTTTTTGTGTTCCG
ATTCGCTAACTCGATTTGCTGCTCTGTTATTAACGCATTACGTGGGGCCT
CAAATGGCCAACGCCTCCAATCTTGGCTAGCAATCTGCGTGTGCCTACAA
ATCACACTTAACCTAACTGAAATTTAATCCGAAACAGCGGTAATCGCAGC
AAAACTGTTATACCGCAATGTGTGCGTTTAGAATTCCTCTTATTAAAATT
GCATGTGCCGCAAAATGCAATGCACTCAGGACGTTTGGAAAACTAGGACG
TTGCCCGTGACACTCGATATCCAAAGTTTCAGGGGCCAAAATGAGCGGGA
TGGATTGCTTAGTGGCCGTTTGCACCAGGTGTCTTTGGGAAATTAGCTGG
CCCATTTAAAACAGAATTCTGTGCCAAAAAACCAAACGCAAGCGAGTGAA
ATGTGGGTGAAATAGGGCAATGCACTGAGAAAAACTACTTAAGGTAATAT
CAAACACAATAGGACTAAACTTAATACTGAGTTTTAATTAAAATATTTCA
AGTAAACGTGACAAGTTTGATAAAAGGGACATTTTTCTTTCCACTTTATG
AGCGTAAATTGTTTTTCCCACTGTCACAGATGTTCACTTTTTGCAATGAA
TAAACTATCCTTGAACTATTCATCTTTTGCTGAGGGAACAGAGCTTTGCA
CAGACAAGAACACAAAAAGATTTTTCTCCAGCTGGCCAAGAGCTTTCCTC
AGTTCTTTATTTCCTCGTTGCTGAAAGGTTGAATGAACCAGTGATGACTC
TTCAATTATTGTCACCCCACCCTCTTCGCAGCACCCCACTAAGAGCACCC
CTTCATGTCCACCATCCCCTTTCTTGCTAATTCCCATGCCTTCTTTGTTA
ATGAAAATGAAAATTGCGCATACGCCGTGTTGTGTAGTCAATGCTTTTCT
CGCTTTGTTTGGCTGCTAAGCGTTTTTTTTTTTTTACGCTGACAACGCTT
TCCTTGCCATTGCCATTGCCCCGATTCAGGTACAGATACAGATACAGATA
CACGGCGACGGATACAAAAATACAGCTTGTAGAATATTGTGTTTTCAAAA
TGACGCAGTTTGATGCTTCGACTGTTTTACCTTGCTGTTTTTTGCTTGTT
CAACTTGTTGCGTTGCTTTGTATGCGGCACCCGTTTTGCCGATGAGCCTG
GCCTCAGTATCTGTCAGATACATTGCCTATCTGGCAGCTACAGTCGAACT
TGGCCCATAATCAATCCGAATTGTGGGAAATCGTCATATCAGAAGACTTG
CGACTATGCGAAACTACCGATTCCAAATCATGTTTTTTGTTCCACTTAAG
TTTAAATTTATCTCGTGAAGTGCTCGGACTTCTCCCCAGAGTTCTACTGT
ATGTACGGGTTACACTGAACCGAGCTCCGCTCCTTCGTAATCTGCTACTC
GCATTTATATGTTAATGTGGGCGTGTGGGGGCGGTTGGCACCAGGATACA
TTTCAGCGCGTGTCCTTGTATTCCACGGCTGTCAGTTCACGTTAACTTCT
GTCGCTCGTCACCGCACCATCGATGCCTATCAGTTGATGCTTTAAAGGCA
CTTCGCAGTAAACCGTCAACAGCTTGTAAATAACTTGACGATAAGGTGGC
GAAGAACCCTTACTTACCCCTCTATCCGTGTTATCCGCACCAAAAACTTT
ATAGTTTGTTTGTTTTTCTTCTGCGGCGAAGGTCGCGTGGCTCTCAGAAT
TATGCAATTTTCGTTCGCATTCAATTTCACTTATTGTTCTAAGCTTTTCC
CCGCTTGTCTTCTTTGCGCAGGGTATTATTTATTATAAATTGACACAAAT
GAATTCAATTGAATTGCCTGCAACAATTCGTTTTTGGCCCTGTTGCCAGG
CGGTGGAAACTGTGCTCATTCTTCATTGTATTCTACATTGCTCCGTATCC
GCCATGAATTATCCAACGCTTGAGCAGATTACTTATCAATTTCAATGGGG
CAGCGAATAAGCTTCGTTATGGGAAGACCAGTCGTTTCATTGCATACGGG
TCAGTTCAATCAGCAATGAAGGCGTGCGAATGTGTGTGACTCACATTACG
CATACGACGCGTGGGCTGGAAAATGAAAAAGTATCGTCTTCTCTTTTATG
CTATTGCATTTTGGGAAAAGAAGATATATTATACATTTATTTTTCAACAA
CGAAATTGCATTAATATATTTATGGGTTAAATGATGTATAGATTTTATAT
GGTAAAAGTAAAGAGCATTACTAAACGCACATTCGATTCATTCGGTGAAT
GTATAAAACCATGTATATCAAGAAGTGCAGCGTTTGTATAATTTAAGCAC
AAGAAAGCAATTTATTGCTATCTATATGTGTCATAATAGCATATACTGCA
GTATTCTTTATACTGGATTCTTTGTTCTCCAAAATAAACTTTAGCCGCCA
CGCACTTTGGTTTGTTTTCGTTTTGCTTGTGAGTCAGGGAACTGATTAAA
AGAACTAATCAACAAAATGAATTACTTCTTATTATTGTAGGCATAGAATT
ACATGGTGCTATTGCTTTGTACACCAAATATTATAAGGAAAGCATATTTG
AAATCGGTAAAGCATATATGTATATATGAAGCTTCTGTTAGATAAGGCTA
ATAACTATTTTTATGACTTTATATTTAGATTCCGATAATTTGTTTGTGGT
GCGACTTTTATATCTGAAAATATGGTTTTGTTGCTGATTTGCTCAATTAA
AAGGCGTCCACACATCGTGTTTACAATTGGTGACTTTCGGATCGAATCGA
AGCTCAATAAGCATAAATTACTCATAGAGCGGGTCTCGGCCACCGGTTCC
TACGATTTCTGTTGCTAGCTAATAAAAAATTGAATAAAATCGCGCGTTCA
ATAACAGCAACAAATGAATTGTGGAAAAGGGGGGAGGCTCTCGGAATGCC
AGTGACTTAACCGAGTTGGACCCATATTCATTGGATGTTTATGTTTGGTT
AGGGAACGGAAACAATTACGAAATCTTTCTTTCTTTCTTTTCCCCAAATA
TATGCCCATACATATATATATATTGTGTATGTGGCCTGATCAAGTGCAAT
TTGAGACTGGAAAACAAATTCATTTGAACCAATGAAGCTTGGCGGGCCAA
CTGTTATACAGATGAAACCGAAAGCGTACTTTTGAAGACGATTCGGTTTG
GGGGGCGGCATGGGAATGCCTGTATTCTAATGGATTGACATTGCTGCGAG
CGAGCCCCGACCCCTGGTTGATTTTTCATTTATCACATGGAACATGGAAT
AACAAATGGAAATTGAGTACAGTCCCGCCGCCTTCCGTATTATATTGTTG
TTTCGTGCCTGACAATTTCCCTGTTTGCTTTTGTTGCAGTAGTAGTCAAG
CCAATGCAATTTACCTGTGCACTCAGCTCTGTAATTATCCATCCAACCTT
GTGACAGTGCGGATCGTCGCTCTCTTTCGCACTATCCCGACTCAGTGCGT
CCCTCTCTATTGAATCGTTATGGCAACACGTTCCAAAGCGGTTGTTATTG
CACCCAAACCGACGACACCCTGGCACAGATTTCGCCCCCTCAGCGCGCAA
CTTGCCACTATTTTAAATGCATTAATCTCCACACATTTCCATACAGTATT
TGCACTCGATTTGCTCGATTTCACCTATATTTATATTTATTGAACAACAC
ACCGTGCACACTTAGTTCTCGGCTTGTTGGTCGCTAATTGAAATTAATTA
GCGCACTCGAAATTCCGTGGAGGGGGAAAAAGGGGGGGCTCCCATTGTCA
TATGATATGATGCCTTCAATCGATGGACCCCGCGGGGGCGCAAATATTTC
CAATAATAAATGGGCGTTTAACACCAACTGCCAATGGACAAAACTCCAAA
TTGAAGAGCACTTGGTTAGTGCTCAAGCGCTAATACACATTTTAGCATGT
TCAAAATGGCCAGTAGGCGGTTATAAATAATAAATGATAGCAGCACAAGT
ACAGGCTGCCCTGGGAAAGTCGTCTTTGGAAATGAGATCCAATTCGAGGA
ATAAATTTAAATTTTGAATCGAGAAAAGAGCGGGCAAGGTATGTAACGTA
ATCAAAGTAGTATTAGGTAGTAATCGGATCCTTATTGTACAATTCTTAAA
CATTTTGATATTTTGTCATTGTTTTTATAAAGGGAGTGATTTATTTATCA
GGCTTGTATTGAGATATTTCTGAGGTATGCTCTCGATATCTATAGTTTAC
ATTTCCCAATATTAATCCCGACCCAGATTTCGCTTTGTATAAATGAGGGA
GCGATCTGTTTGAACTGAATCTGGGATGGGAGGGAGATCACATGGATGTT
GACTGCCATTCGCCTGTGTTGGCTTAACCTTTTTCCGACTCTACATTGTA
AGGTTCTTATCGAGTTGGGAACGAGTGGCCATGCTGGTTTATCTGGTGGC
TCATATCAGGGTCGAGTGCGAAGTTCAAACACCTAGCAACAGGCCAATCA
TCCGCCAGTGATTTAATAACAATTTGGCCCGCCGAACAGCGTAAATGGGG
TCTACTCTCCACCACCTCGCACTGTTTTTTCCCTACTTGAGTTTGACATG
GATTAGTTATGTTTTCTATTTGCACTGATAGCTGCAATCGATGGCCCGCT
TATCAGTATCAGAACGAATAAAGCAGAAAGAAGGGGGGGATATGAGAACA
ATGCCTGCCGGCAGTTATTGGATCATCCATAAACATATGTAGACTGAAAA
CCCCCATGGAGCCGGAAAAGGGAGAGATATGCGTGCTCTCTTTTTGGATC
AGCTCTTTGTATACGAATATGCAGGCAGATTAGTAGGCTTATCCGTATTT
GCTGTGGATATTGTTTGTTAAATTTGTCAGTTCTTCACATTATATCGAAT
CATTTTGGGGTTTAATTAAGCATTAATTGCCTATGGCTTCCCAAAATTCC
ACCACAAGTCAGACAGCCAAGCATTCCGTCAGTGATCGTTGGAGTTCTAA
GCATTTAGCTTCAATTGGCATCAATTATGTTGATTTTGTAAATTAGTTTG
CATGCGGCAATTGAATTTCTTCTCACATTTCAACAGCGGGTGCTGGGAAA
TTGCCATTTAAGGTCAGAGTAAAAGCTTTTATTGATTGTAATCAACTTTC
TTGCTCTTTGCAGCTGACAAGAGTTTGACACAGAACAACAACGAAGTGGT
GGCCTTGGATGAAAAGTTGGCCAACGAGAAGCAGCAGCAAATCGATTTCC
ACCAGCAGCAACAGGAGCAGCAGCAACAGCAGCAGCAACAGCAGCAGCAG
CAGCAGCTTCATCCACTAGCACAGCAGCAGCAGCAAGAAGAGCAGCAGCA
ACCGCAGCAACTACAGCCGCTGCAAACCGAAAAACCGCCAACGAAAGTGC
CAAACCTTGTTGTAGCTACAGTGGCACCTCAGCTGCAACAGCCACCGCTG
CAGCAGCATCAGCAACAGCAAACATCACCTGTGGTGGTGTCGCCAAAACA
GCAGCAGCAGCAGTCACAAGCTGCGCACCAGAATAGCTACCATGATCAGC
ATCCTTTGCCGCAGCAGCAGCAACCGCAGCAGCAGCAACCGCAGCCACAG
CGCAAACCCTCGCAGCAATACAATCAAGCGCAGCAGCAACAGGTGCGTCG
TAAGTACTCCTCAGAGTACAATCACCATCATCACCAGCACGGCAGCAGCG
ACACGGGCATCCAAACTACCAAGACCATGTCCTGGACCAATTCAGCTCAG
CACAAAAAGTCGACGCAGTCGGTGTCGGTCACCGCTTCTCCCAATAGTGT
AAACAATGGACCTGGAGTGGGTGCTGCGGGCAAAGCCAACTATAGTCACA
CCACTAAGACATTTACCAATCAGCAGCATTACCAGCAGCAACACTATCAC
ACTCAGAACAGCTATAACAACAACAGCAGCGGCGGAGGAAGCAGTAGCAA
CAGCAGTTCGAGCAGCAGCAACAATCAGCCCCAGGTGCGCAACTATGGCA
CCATGAAGATGCCCTCTTCGCCGGTGGCTTGGACAGCGCCAACACCGGAG
CGCAAAAACAGCCAACAGGCAGCAGCGGCACCGGCAGCAGCAACAGCGTC
TGCAGCTCCCGTGGCAATCACAACAGTAACTACCTCAACGGCCAGCATTA
CGGCTACCCCAAATCAATTTCAACCGGAGACCGGCAGCAGTAGTGCATCA
CCAGCCGTAGCTGCCGCGCAGCAACAGCAGCCTGCAGCACAGCAACATGC
GCAGGCCGCACAAACAGGAGCAGCAGCAGCTCCAAGCAAGTCCCACAGCA
ACTATGCTTCTTCTAAAAAGCATCAGAGCTATGAGCCAGTAGTGCTGAGC
TCCGTGGTGGCCACCAGTTCATCAGCCAATCCGCAGCCGCAGCTAAATCT
TGCCCCACCTGCGCCACCAGCCTCGCAGAACAGCAGCGACAGTTCGCAGC
TTTCGTGGGCCAGTTTGTTTGCCAGCAACAAGCCCGTGGCCAAGGTGGCG
CCCTACGAAGCCAGCAAAATTGCACAGCAGCAGCCATCCCATCCAGTGCT
TCAATTGGCTCCTCCGCAGCCAGCTCAAGTGGCGGCTGCCGCCCCAGTTG
CTCAGCTGTCGTCGCCTCCTCAGAATTTGCCCCTGCCTACGGCTCACCAA
CAGTCACAGTTACCAGCACCTGTGCCGGCGCCCACGGCTCCGCTGGTCAC
TCCAGGAGCGCTCTCCTATTCGGCTGCATCCGCTCAGGCAGTTCCTGCTC
CCAGCCCCGCGTCGGCATCCGTCAAGCCCCTCAAGCCGGAACCACCGCGT
CCTGTGCAGCAGCAACTGGATGAGTGGACCAGCAAGTACGCTGAGTACCT
GACGCGCCACAAGACCAATTTGGCGTCGATCAGCTTGCGTCCCCGAGGAC
TGACCAACAGGTCGAACTATTGCTACATCAACTCGATCCTGCAGGCACTG
CTCGGCTGCTCGCCGTTCTACAACCTGCTGCGCTCCATTCCCAAGCAGGC
GGCTGTCCTGAGCGAGGTCAAAACGCCCACTGTGAACGCCATGTAAGTTT
ATAGCACGAACTGGGGGGAATGGGTCTAACACTAAGTCTGAGAACTGGGA
TTGAACTTATATTTGGCTCAATCAAATCATTCGAAGCCAAGCCACAGGCA
AGTCAACAGACACTTCGGCACCAATTGCCAGCCGGCGTCTGTGTTACGTT
TGTGGAAGATGAAATGCCACCGGCTCTGTCTACGCTCTTTGGTTACCTCC
GTTTTGGCGGTAGCTGCTGAGTGTTGGGGTTGGTGCACGTGCTCCGGTTT
TAAGTAGAAGATCTCACGTTCATTGGATTTCTTCGCCGAATGCGGCACAA
ACAATATTATTATTTTACACAGCCGTTTCCGTTTTATAACCTTTCTTTTT
TTTATTGCCTATAGGATGTCTTTTATGACCAACTTTTCATCGTTGCCCAG
CGGTCTTCGCCTGCGTCTGAACAACCTTAACAAGGGATCGCAAAGCAAGG
GCAAGGACGATTTTGTGGGCTCAGATTTGCAATGCGACATGGCCTTTGAA
CCCACAGAGATCTACAAGCTGTGGAACGACAGTCGCGAGGAGCATGTCGA
AGGTCGTCAAGAGGACGCCGAAGAATTCTTGGGCTACGTTCTAAACAAGC
TGAACGACGAGATGCTGGAGGTAAGTGTTTGGCAAAAGTTGTGGTTCCAG
ATTTCTGATTGTCTTGTTTGCTTTGTTGCAGGTGATTAAGCTAATTGATA
AGCCCACACCCCAGCAAAATGGTCAGGAACCCGCGGAACCAGAGGATGGA
GGCGATGTCTGGCAGGTAAGTTAATTGCTTTATTATGATGTCATTGCGCT
TAATTGAATGTTTGCCTCCCCAGATGATTTGCAACAATCGTAATAAGGGC
AGCGTAACCCGCCAGACCGACTTCGGACGCACTCCCGTAAGCGATATCTT
CCGAGGAGAACTGCGCTCCCGGCTGCAGCGTGAAGGAGAACACTCCACGG
ATGTGATTCAGCCTTTCTTTACGCTTCAACTGAATATCGAAGTGAGTTTT
GAGTGTTGATACCATTTTTAGAATTTGTTTTATGTTTTTGGCTTCGTCAT
AGCTTTATCCGTAATAAATCATTCAATCACCACAGACAAGTCAACAGACA
CTTCGGCACCATTTCTCAGCCGGCGTCTGTGTTACGTTCGTGGAAGATGA
AACGCTCAGCCTCGCCTGCGTTTGGTGATTGTTTCCGTTCTGGCGATGGT
CACCAGACGTTGGGGTTGATGCACGTGCTCCGCTTTTTAATAGAGATAAT
TGTATTCAATAGTTTTTTCAACAGTGGGCACAAACAATAAATGTAGAATA
ATTATTACTAAGATAATCTTGCACAAATCAGCTTTTTAAATTCATTAATA
TTATATCTCTACAGAAAGCTGCATCTGTGAAGGAGGCACTGGAGATCCTT
GTGGGTCGCGATCAGCTGGAGGGAGTCACAGGCAGCAAAACCAAACAGGA
GGTGGTGGCCTGGCAGCAGATGACGCTGGAGAAACTGCCCGTCGTTCTGA
TATTGCATTTAAAGTACTTCGACTACCGCTCTGATGGGTGCACTAAGATT
TTGAAGAAGGTGGATTTCCCCGTGGAACTAAAGATCGATGCCAGTATGTT
GCCATTAAATCAGCATTACCGTACCGATGTTCATTTTCGACTTTGTTTCA
GAAATCCTCGGCTCAAAGAAGACCTCGCAGAAGCAGCGCGCCTATCGTCT
GTTTGCGGTTGTCTATCACGATGGCAAGGAGGCGTCGAAGGGGCACTACA
TCACGGACGTTTTCCACACGGGCTACAGCAGCTGGCTGCGCTACGACGAC
AGCTCGGTGAAGCCGGTCAGCGAGAAGCATGTCCTTCAGCCGCACACGCC
TCGTGTGCCTTACCTGCTGTACTACCGCCGTTCAGACACCCTGCCACCGC
AACAGCAGCAAACCCAGCAGCAGAATGGCGGAGGATCAGGTGGAGTCGTG
GGCAGCAGCTCATCATCATCGAATGCCGGGGATAACAAGTGAAAGTGAAC
CACAACGCGGCGTTGTAAAAATACATCAGAACTTTAAGTGCTAGCGATAT
ACTTTATATTTTTGTGTCAGTGCGTGTGAGCGAGCGAGAATGCGAGTTTG
GTTTTATATGCATATACATATACAAATTAACAATTAGATATATTCGAGCG
GTATATAGTTAAGCCCAAAGTCCAAAGCGCATGACCGTTTGTTAGAGTAC
GATTGTGTGAGAAAGAAACTTAGCTCTAAGCTAGACTAGAATTAAGGTTG
AGTAGAAAAATAGGCAGCAAAAGAAACTCGTTGGAACGAAAACTTTGTAC
AAAGAGAAACGAAAGAACTCTGTAAACTAAACAGCGAGTAAATAATTAAC
ATATAACTTAGTGCTAAATTTACAAAATCCTTCAGCGTAGCGAAACCCCA
AAATATCTGTGGCACAAAAGCCCTCCCAGATGTTAGAAGTAGTGGATGTT
AGAAATGCCCTTAAATACCTTTTGGAATTTGGCGATATGTTATGACAAAC
GCTTACAGCTGTATATATACACAAATAATCATATATTGTAGTTGATCAGT
TTCGCGGCATGCACCATGCATTTAAACAAACAAACCCAGCAACAATATAT
ATCGAATGCTTTGAATATGCTTTAAAGAAATATACATTTAGAACCAAGGT
GTTTTCCACACAAAGAGTAAATACAGGCAGTGGTGGTCAGAGCAATAGCC
GCAAGCATTTCAGCATCTGTAAGCCAAATTGGGTTACTTTTGTTATGGTC
TCGAAGACCAAATCAAATAGATATTTCCTTTACTAACAATTTTTGCTCAT
GTAGATGGAAGTTTAAACATGAAAGTAACGAGCTGAATAAATTATCTATA
CGGCTTTTCTAGACCACTACTGCATGTTGCATTGCATATAAGCAGCAAAG
TAAGTTAACAACGCGTTCATTTTGTAATTTATTTTATATGTTGTTTAGTT
TTATACGTAATCAGTTAGGCGAGCAGATTCATATATACACAAACGGAACT
TGTTATTCATAGTTAGAGAAACTTTTTAGGGATTGTCTCCCCGGCTTGGA
TGCGATGTTTGCCTTCATGATATTCGAGTCCTTAACTTTCTTTTCTCAGA
CCTAGAGCATTTAGTTTGTACATCATGTTAGAGAAATCTGTTGGGATTGT
AACAAAAGATTTGAATGGGAATAATTATTAAATGTAATCGGGTACGAACT
AAAGCTAATCAACCATACTAGTTAATAGATGTCTTACAAACGTATACACC
CATATATATTTTCTTAAGCTATGTAATCTAAGCGCATATATATTATTTAT
AGATATCGTGCCAATGTTAAAACATCTAAAAATTTTCAAAAAAAAAAAAA
ATGATTATTTGAATAAGAAGACATTACAACTTGTCAAAGCTTTGTCAGTG
GCTAAACAAAAAGAGAATAATACAATTAATTAACGATTAATAACTTCCCT
TATCATTTATTTGATGAATTCAATTTTTAAACATTATAAAAGCGAAAAAA
TCATTGCAGGCTTTTCGACCATTACGCTTTGATTTCAAAGAGTTTGATCG
GTTTAAAATGTTCAAAGATACTGAAATTCACCCGACAAGTAGACGTTCTC
AAATGGATTGTAATAATTCAATGCACTTAAGAACCATATCTTGAATGGTG
AGGGAATAAGTTGAAATCTTTAAATAATCTTGGGATAATTGTATAATAGT
GGAATGGAATGCATTGGCATATTTCGCATATATTATGAATAGGACTCAAA
AGCGAAACCATAAATATAAATCTACATATATATATATATTTTGATGTTAT
ACATATATGAACTAATTTTAAGCGAAATTATAGGATTTTTATAGAAACAT
GTACGCGTCTGCGTTTTGCTAGTTACAAATAGGTTCCTAAAACTAAACGC
AAAAATGATACAACCACAAAACGGAAAAAAAGATGTAGAAGCAAAGGAAT
ATTGAAAAACAATAATATTATTACTGATATATGTAGTTTAAAGCCAAGCT
AAACCGTAAACAGTAAAATTTAACTGAAACAAACAAACAATACATATAAA
TTTATAAATCCAATTTATACAAAAACCACGCAAAGCAAACAAAAATGAAA
AGATTGAAACATGTTGAATTACCATTTAAATATATTTTTGCAAGCGAAAT
TAGAATGTCAAACATAAACGAATGAAATACTTAGAATAGAACTAAAGCCG
TAAAATTGTAAAATTTTCGATTATATAAAAATATTTTATTTTTTTTGTAA
CTGTTATATAATTTGTGGAATACTCCAAAAAAAAATGTATGTTTATCAGC
ACCTATTGTTATGTCCAATACGAAAAGTGTGTTTTAAAGCCATTGCGGAA
ATGGAATTGGTAACTGAATTTATATCTTATTTAACCAATTATCTTTTTTT
TTTGTAAGCTCCAACTGCCTGATGGTCTTGAAACGCACTGTTCTGTGTCC
TAATTTTTCGTATAACCAAAACATGATTTTTCTTTGAAACTTTTATATTT
TTTGTAATACCCAAGTCACATTCTGTTGTCCCCGATTAATGTATGTTTTA
GTTTTAAGTAGTTTCTAAGGCTGTGTAACTAACTAACATAAGTAATAATC
CCTTTTTGCGTATGGCCAGGTATAAAGAGGTATCGTCACCCCGAATGTTG
TAATTAAGTTTGCCGGACAATTTTTGTTTATTTCGCAACCTTTTCCTTTT
TTTTGAAGCCTCTGACCAGAGGCTCCTCCGATAAACAGAAATTGGCAAGT
GCACTTACTAAACGTATAACGAGGATTAGCATGTAATCGGAGGAAGTAAT
AGAGTTGCTCCAAGTACGCTGAGCCAGCTGACAAACTAATATTACAAGTT
TTGTAACAAAGTTTTCTAAGGCCAGAGATGAGTGTATGAAAGGCGGCGAA
AGGCCCAATAGCAAAGAATAACAAGACACTAGATGTTTAACAATGCGAAA
CGATTAACAACACAATCTGAAGTGAAATAATTAGTCCACATTTAGTCTAA
AGAAACCATGCTAAAGTAAATCTACAAAGTAAAGCGAATTCAGTTAAACT
AAGTAAACATAACAAGCGGATATGTACCATGGAAAGCTAAATCATAAACG
ACCGAAATGAAATGAACATTATCTAGCAATAAAATAAACGAGTGATTTCA
TTGCCACAAGCAAAGCCGTTCGCTCTGGATTAACTGGGATTTCAGTGGGC
GAGAGGCGCTAACTTGTGCCGGAGTGGGTCAAGAGGAGGTTCCAAACCGG
TTGGCCACAAAAATAGATGCCGGTGCGTTCCTCCGGATGCTCTTGGCCCA
CGAAAGGGAAAGGGAAACCATTCGGCGGCTAGTCAGCCGATAATTGTCAG
CGACTTTGGACCAAATTTAGTCTTGTTTTGGTTTCCTATTGTTGACTATT
GGAAAGATTTGCTGAAAGAGACGACCGACGCGACATGGCAGCGAAGACGA
ACTCACCGCACCACGTGTGACTCATTACAAATGCCAATCACAAGCCAAAG
CTGAAAACTCGTTTTGGCCGGGCTGAGAGAGGTGCACTTGAAACAAAATC
TTATGCGGCAACTTAAATATGTTTTTTTTCTGATTATTAATCGTTTTTGG
TTTGCAGCCTTCAACAAATTGTTTCCGTTTCTTATATTATGTTTATAAAA
ATGATTTATTTTTTGTTGGAAGCTACTATGAAATTGTTTCTTTCAGTGAC
TTTAATTGCCCACATCTTTCTCAGTTGGGGGAGACTCTTTAAGCCATTTG
CGATGTGAGCCCATCGAGCAGTCGACGATCAGCTGGCGGCGATGAGCGAC
ACCGCGAAATGCATTCGCTGTGCCCCCGGCTCGTTTTGTAAGAGCTCCAC
TCCAGTGCCCTCCATTTCCCCACAGCGGAATCGCCAAATGCCAGCTGGAG
CTGGTTAGTTGCAGCCAGGAACACTCTCGCCATGTATCGCAATATACTCT
GCCTGGTGCTGGGCCTCATCATTGGCATTCAACTGACAGACTTCTTAGAG
TACTTTCAGCTGACCGATAGTCAGTTCGCCAGCACGTCCATTACGCAGCT
GGAGGAAGGGGCCAGCCAGCTGGCGACGGAGGAGGAACTGGCCTTGTGGC
TCCATAACGAGACACGGGTACTCTGCATGGTGCTAACCCTGCCAAAGAAT
CACCAATCAAGAGTGAGACGAGTTAAGGGCACATGGGGCAGGCGCTGCAA
CAAGCTGATCTTCATCAGCAGCCAGGAGGATCGGGAACTGGGCGTCATTG
ATGTGGGCGTGCCCGAGGATCGAAACAACCTGTATCTCAAAATGAGGAAG
GCCCTAGAGTATGTGTACCGGAACCATGGAGAAGACTACGACTGGTTCCT
CAAGGCAGATGATGACACGTAAGTGAAAACATACCGAGTTCCAAAATCAC
ATATTCATTTTCACCCAATTTTAGCTTTGTGATAATGGAAAACCTGCGCT
TCCTGCTCTATCCCTATGATCCCGAGGCAGCGCTCTACTTTGGCCACAGA
TTCCGCACCACCTTTCCGCAGGGCTACATGTCCGGAGGAGCTGGCTATGT
GATGAGTCGGGATGCACTGCGTCGGCTCAATCTCTTTGCCTTCAACAACA
GCCAATTCTGCCCGATTAACAACAATTCAGAGGACAGGCAGATTGGCTTC
TGCCTGCAAAATGTGGGAGTAGTTGCAGGGGATTCGCGGGATGAGGAAGG
CCGGGATCGGTTTCTGCCCTTGTCTCTCAAATTTATGCTGCCTACCTTTC
CCACCGACAATTGGCTGCCCAAACTGACATTTTATGAACCAGTATGTATA
ATATCTTAGAAAGTACTACATTATTTCTAATATATTATTGTTTCAGGTGA
ATGAAACTGGCTCGACTTCGGGAATCAGCTTTCACTATGTCAAAATCCAC
GAGTTCGAAATGTATGAATACCTGCTATATCGATTGCACATTTTTGGAAC
TCCCTTGTCCCAGAGAACGCTGCCACCCCGACTGGGTCCCGATGAACTGC
AGAATCAGCTGAATCAGTGGGCTCAAGAAAATAGCACGAATTCAAACGCG
TGGCTGAAACAAGAATAATATATATAGTATATTAGTACATATTTAAGACT
CATTTTAACATACCGACAGTCAAATAGAATTAGTTTTTAAACTCTTAAGA
ATATCATTAAATAGAAAACAATTGTTTTTATACTTTCAAGACTTTGTGAC
TGACTGCCATCAGCAGTTTACCAACGAACAAATTGTATTGTTTCACGGAC
TCTCTAATCGAAATGTATAAACGAAATTGCTGCGCCAATTGGACACAGCA
TGGGATC