P[acman] BAC CH322-101L04

CH322-101L04 is on chromosome arm chrX from 2425736 to 2446736.

BACPAC Resources is the distributor of clones for this project. Investigators requesting a clone will need to establish an account with them. They will also respond to all questions regarding shipment and availability.

Return to the Browser

The sequence for the BAC is deduced by extracting the sequence from the reference genome based on the alignment of one end of the BAC and the estimated location of the other end based on mean insert size from the library. The sequence of the BAC has not been confirmed over its full length, nor has the sequence been aligned to the MboI restriction sites (GATC) used in the BAC library construction.

>CH322-101L04 21001bp
GATCGCAGGTGCCGCTGGCGGAGGCATACTACTCCTCATCGCCTCATTGG
TGGTCTGCCTTTGCCTAAAGAGACGGGAAAACTCTCAGCCGGAGGGTAAG
TCCAGCTTAATGGAGTGGAATATTCTCATGCTTATCAAATTAAATCTCTG
CATACACAGATGAGAACAAACCGCAATTGGAACACATTCAAGCGGACTTT
GTTACCTCCGCCGTCCTGGGAGTTGGTGGCCACCACAAAAGTGGCGATGT
AAGGCGCCTCAACGGAGTGATTCCGAGGATGAATATTACGCCCAATCCGC
TGGCCCAGGAAACGGCATCCGATAAGGTAAACCATGAACTTCCGGGTCTA
AACTCGAGCTCAATTTTCACACAGCTTCATCCAAAACTTTTCGCTGGTTG
GTTGGTCAAAATTCAAATTCAAATTGTAAACACCCCTTCGAACGTGGTAT
CTCTGTCTCGCTTGCCCTCTCTCTTGCTGTCTCTGTCACTTTCGCTTGGT
AACTCTGCCAAATCTCGTCGAGATTCGCCCGCAAATTGAGAGTCCAATGT
TCCAGAACCGCAACGTGATGGAGCTGCGTTTCCTGCCGCCGCTGGCGAAT
GGAAATGGAAATGGCAACTGCATGGCCAGAGATCTAGCCCTGGAGCGGTC
GAACGCGGAAGAGCAGCAGGATGAGGACGGACACGAAGATGAAAAGGGGC
TACCGGCGGTTGCCTCGTCCTCCTGCGAAACGCTGGAGGCCTGCGACGCT
GCAATTAAACTGAATCTCCCTCAGAAACACGACCAGGAGCAGCTGGATGC
TCCGAACGCGGTGCTGGAGGCGCCCAGCAAGCCGCTACCTCCGCTGCCCA
AGAAACCAGCAAACGGCGCTGGCCAAGTAAGCCTGCAATTGAGATCGAAA
ACAATAGCACACGGGCGCATACCAACCGATACAAACAAACACTGTATACC
AATTTTGACAACATCATCTTGCTGACAGTCTGTGCATACAACTCCCATGT
GCTATTGCTTTTCCGCCTCCGCAATCAGGATAAGCCAACCCCCAGCCGAT
ATTGTTTTGTCAACATTGTCATTCATTCACTCATGAAATAACGATTCGCC
TAGTGCCCTATCCTGCTAATTTATGTCTCCTAATGTTCCACAGAACAACT
CTGGACTGCATCAGAATGGCCTTCACCACGCACAGCCGTACCATCCGCCT
GGCACGCCCACTCTGATGCACAAGCGACTGGACTACCACCAGCAGCCGCC
GCCGGTGCCTCCGCACTCGGCCTATTACCAACAGGCACCCACGCACCAGC
CGTCGCCGATGATGGAGCGCAGTGTCAGGGGTCACCAGCAGCCCGGGGGC
TTTCATATGGAGGAGGGCACACCCACGCCGACCAGGATACCATCCCTGCG
GCGACAGCGACGCACCTCGGGCAACCAGCAGGTGCACAACAGCCACAGCA
ATCTCAATATTGGCCTGAGCCACCACAACAACAACAACAACAACCTGCCG
CCGCACCACCAGCATCTGCACCACCACCCCGGCCATCCGGGTGGCCTGGT
GGGCATACCCATCGTGCCAGGGAGCCCTAGGGTCCAGAGATCGCCGATGC
CGAGCAGGGCGATGATCAAGAGGACGCGCCTGGGCAGCCACACGGACAAC
ATATCGTCGGGCAGTCTGAACAGTATTGAGGTGTGATGGCTCGCAGAGGA
GGCAACTAACTAGTGGACTAGTGGGCGGAGCAGCACAACGAGGAGAAATA
TACCTAAGCGGCAAGCGAAAGTGGTTCCCCAAAAACAGACAGTTTCAAGT
AGACTTAAGGATCCGAAACTAGATGTGTATTATTGAGATAATCGTAGGAC
AGGTCGGCAGAGCAGCTCGAAACCCTCGAATATTAGCTTTAAGGCACCCG
GTACTGTTTAGTTTTCCAAAAAACCAATTAATTTGGCCAATCATTAAGCT
TAGAACTAGGGAATTTGCCATTAACAGAAGTTTCTGTCGTTTCAAATGCT
CGAGTAACTTTGTGCTAAAACACTAGTAATCAAGTTTTGTTTTCATTTTG
AGCTCATTAAAATGTATTTCGAGCAGAACGTTTAATTAAAAGAAAAAAAC
AGCTAAGCAGCTAAGTCGTTAAACGTTAATGCTGCTTCGTTTTGTTTTAG
TTAAATATTGAATTTGAAAATATACAAACTTTAGTATAAGGAATTGGTAA
TGTAAGACTTTTTTCGTTGCTGCCGGCCAGATAGTCAGTAGAATTACTAA
TGTTAAGTTTTTTTTTTTATTATTGATAGAACTATTTCGGGGGCCAAATT
TTATCTCGAATAAGCCCTGTAGCATAGCGTTATTTATTTATTGCAGTGTA
AACGTCAGGCGTCAGCAACTCAAATTGATTAGTTCAATTAACAAGCAACC
TAATGTACGTTTAAGTCAAACCAACTATATAGCATTAAGTTAATACATTT
CTAGATGTGACTAATACACAAAACCCAAGAGAGAAGCATCCTAAACTCGA
TTTAAGCTCATAGGCGGCAGTTTTAAACGAATATGCGAGTCCTGAAATTA
AAAAGTGAATCTTTAAACATATTTTTTAACGTATTTTTGTTTTAATGATG
GGAAATTTAAGTGCTGTCATTCAAAATACTGGGATTTTCATATTCTTAAA
TACCATTTTTAAAAATCCCGCCTTCATCTGGCAACTCTCACTGGCGGATG
CACCCACCATGTTTTAGCGAGTGCACCTACCATACGTGACTGCCATGCGT
GACTATCGACACCTGTGCCAGCTCTAGGACAGCAACAGCTGATTGTCACA
TTAGAATTGAATTGGAATTAGATTATTAAATATTTTAGCGCTTTTATAAC
ACAAAAGGCCGACTAAATAGCTTCCGAGCAAGCGCCACCAATCCGAGCGA
CGGCTGGTACTACAAACTGAACAAAAAACTACTGAACAAAACTCCAAGAG
CATGAATTTTCTGCGGCAATCCTTTGGCATTACGAAACAGTTGGCTTCGC
AGGGTAAGCTTAACTAAACCAAGTTAAATACCTTAAAAATCGAATATTTT
AATTGATTTGGTGGCCATTAGCTGCTCCTAAGCAGGAACTGGCCCTCAGG
AGTCCGTGACTTGGCGCATTTAGCCACCCTTCCGCTGCGAAGCGAAAACC
AAATAAACCGGGAGCGCATAAGTGTTTGTTTTCCCCCCGACTTTCGTGCA
TTTCCCCCAGGTTTTACCAACTCTTTTTGAGTTGGCCGCGCGTGGCGGCC
GCACTTTTCGCCTGCGAATATTTTCATTGCCAGTTTCACATGCACATCAA
CATGCACATTCCGCAGCTCCCCCGCTTTAGATTGGAAAAATAATTGAAAA
CCTGTCACCCCGAAAAAGAAGGAAAAGCGCGGAAACAATGGAAATGTTCA
ACCGCAAAAAAAAGGTCGCAGTTTAGGAGACAATAGGTGCCGGATTTGTT
TGTCCGGCAATCCTGCATATGGAAATTATTACCTGCCGCTTGTGTTGTGT
GTGGCATTTGGCATATTTATAATTGAAAACGCTGCTACGTCGCTTTGTTT
CTGGCCAAAAAGGCTTGACAGGATTCGGAGCGAGTACTTCCATGCTTGCG
CGTCATTTGGCCGCAATTATTGTCGCCAGCCGCCAACTCCGTTCCACAAT
TCTCGATTTCCACAGAGATTAGCCGTATGACAAAGGAGCCAGCACAGAAC
CAGCGGGCATTGTCAATCACTGACCAACTGTCCGTGGAAGTGACCCTTTT
GTCCGCATTTCGAAGCCGGTACAGTCGTGCTTTATTGATTTCGAGCGATC
TCTTTCGCTCCCATCATTGCATTCTCAATCGAGTCGATCGATGGCCGAAC
CCTTGTGTGTTTATAGTCTAGCCACTTTCTCATAATCAACTAGGAGTGTT
ACCTCTAAAAATGATCATGATTGCAATCTCAAACTTGGAGCAGTTAATTT
TGTTGTACTGGTTTTCTTTAAGCGACATATCTAACTCTTTCACTTCTTTG
CCAGCCATCCAGTGCAGCTATGAGACCGCCGTCCGTGGAATGGCATCGCT
GCAGCAGATGCACCGCAGCGGACCGCACATAAAGACGCGTCCGCCGCGCC
AGCCGCTGGATGGAAAGCCCTTCGCCAAGGGCGTTGTCCTGAAGACGCTG
ATAAAGAAGCCCAAGAAGCCGAACTCGGCCAATCGAAAGTGCGTGCTGGT
GCGCCTCTCCACCGGCAAGGAGATGGTGGCCTACATCCCCGGCATCGGGC
ACAACCTGCAAGAGCACAACATTGTACTGTGCCGCGTGGGGCGTCTGCAG
GACGTGCCCGGCGTTAAGCTGAAGGCTGTGCGCGGAGTCTACGACTTGGC
GCACGTCGTCAAGAAGAGCCAATAGTTAATAACCACTTCCTAATCACGTT
GTTCAAATGCATTGCTTCACAATCAACAGACGGATGCGTCGTTCTTATTA
TTGTTTGTTTTTTATGGAAAATTATGCAGCTCAGCCGGCTTAAGAGGTAA
GTGAGTGAGTAGTGACAAGTGAACGGGCTCAGTCAGGATCTCCTTTCGGT
TGGCTGCATTCTCGTAATCTTAAGTCAATAGGCTGTCGCATCATCTTTAC
CTAAGAATAGCCGGGTCTCTCAGGGGAAAATGGTCTTAAACGGCATTTTA
CGCTTTAGCTGGCAAATCCTTTTGCATGAATCCTGTTTGCTTTTTAACAG
AATTGCAAATTTTCTGCCAAATAATCGTTAGCTGAAATGGGCGGCACTCC
AATACGCCCACTCTTCACAGCTACGAAGTTCAATGGAAAATCGATGTAGT
AGTTGGTCCTTTTTGGGAATCCTGCTGGGTGACTGCCGAAAATTAGCTAA
GAAAATTGAGTTCTTGCACAAGGGGAAGTATCTTCTTTAAAGAACTGGGA
CTTAAATACGTATTGATCAGTTCTGATCACAAGTGCGATTGCAAATCACG
AGCTTGGTTTGTTTGGTTTTTTTCGATTGCTTATTCGCTGAAGATGAAAC
GCATATGGGCACAAAATGTAAATATCTCTGATTGCAAGCTATATAATATC
AAACTTTTATTACAGACACAGTTCATAGTTGTTGTTGGATCCTCAACCCG
AATTGTCGGTCCGAATCAAAGTCGTTTCGGTAGTGTCCTGCGCAGTTCTC
ACCGTTAACCCATCCGCAGAAAGGACTGTCGCAGAGACCGTTAGGCAAAT
ACATTGAAGGATCCTTTTTAAGTTAGCCGACGTCGAAGCTGTCGCCGTGT
AGATGTCTTTTTTGTCCACATCCTCGGATGGATGACATTTCAGTGACCGC
AGCAATGCCGTTTCCTCTGTCCGCCAGACATTGTGTCAACAGAGGGCCAG
AATGCAGGACCATGGGTGTACCGTTAGTCCCGAACGAATGTCCTTAGTCC
TGTTGCCTGATTGAGCCATTATGACAGCAGGTCCTTTGTCCCGGGATCGT
TCGTCTTCGCCGTCTTTTCTGCTGAGTCAAGTTGTCCAACATCTTTGGGC
CCCGCCTTTGTTTGCCGGCGTGCATAATTTTTATCAATAAAAACGCCATT
GTCCAGCGTTGAGGAAAAAACACATACGAGTCCTGCTTCCGTGTAATCGC
CGAAGGATATTAGCTGCTTTTTCTTCTTTCTCCTTTTGTTTGCCGTGTTA
ACTGTAAAATTTGCCAAATGAAAAATGACTCCCGGTCTCGGGGATTACTG
GCCAATCATCGAGGCGTTCACACGTCTGTGGCTTGGCCAGAATGAATTGG
CAAAACATCTGGGAAAAACGACATTCAAAAGTTTTTATCTCCAACGAATT
GTGCGACTCAAATCGCAATTTTTCGGGCAATGATTGAGTGTCCGAACTAG
GAGATACGTCCGGCCTATAACCGGCTATCCTGGTTGTATATCTAGAACAT
TTGCGAAGATATAACACATTTTAAATCGAACTCACCGTTGGCCCTCGGAC
TCTTGCATTGACTATATATTTAATTGTTTCTTGCTTACCACAACATTAGG
CGTTAGTTATTGATTTTCTCCCAACTTTGGCCTCTTCTTCTATATCTGTG
AGTTTCTGTTCTGGTCTGTTTTGTGGCTGAGGGCTTTAATTGTGCCTGCA
CCCCTTCTAAACATCCTTTGCACACCCATAACCAATCGATGCTGTCACTT
CCCCGTTTAGTTTTACTCTTTTTCTGCGGACACGAAATGGAAAAGCATAT
AGAAAGGGTGGCGGAGTCACTGGAGTTTGACTGTACGAATTGCCAAACAT
TTTATTTAATCATGGACACGTGTTCGGCGACCTTTTGGGGTTGGGTGGCT
GGGGGTTGATAGTGGATTGCGGATGGTGGAAGGAGGCTGGAGGAGGATGG
ACCACCCCAAGAAGATGACGACTCCGAAATGTTCAACCCTTGTGCAACCC
TTGTCCTTGCGTGATGTGAGTCTCGTAACGCCGGAACCAAAATGGCGCTG
CCAAATGGCTGAATCCCGGAATCCAAGAATCAGTGTGCGATTCGCAATAA
AAATGGTTTCAGCTAAGCCGCATTCCGCGGGGACCTGTGATCCCAAACTT
CTGGTCTGATCTTCTTTAGATCGCACAAGAAAGAGGTTCCTAATTGGCAT
CTTGTTGTTTAGGCCCTTGTCTCCTTTCTTTGGCAACAATCGAAATGTCA
AGTGTGAGTCAAATAATGATGCATAACCCCCGACCAGACGGTCTCTAGAT
GCTGCAACTGAGATTATCCTTCGGAAACATCATCATTTTCTTGTAATCGA
TTGCAGAAAGAGGCGAGAACCGAGCAATTCTCCCTCAGAAAGATCAAACT
GACAAAAAACTGGTCAACGGAAAAAGGGAGGAGAAGCAACAACAAACGAC
GGGCGGGCCAAACCACACAAAGGATCGTCATCCGATCGTCGTTCTCGCTC
TGATGCGAATGTGCGGAATGTGTGTCCTCTGGCCACGTGCAGAGCACACT
CCAATCACAGGCGAGAAAAGACACACACACCTTGGCCGCCAGGTGAGCGG
CCCAAGTGTCAATCGGTACTCACTCGCGATCCCCTTGTGATTTTCGCATT
TCAACCCCAAGCGATCGCAGATCGCATCTGATTCGCCACGATCGCAGTCC
ACGACTCCGACTTCGATCTGTGTTGACATTGTCAAAGAGATCCTGGCGAT
CGGAATATGTTTACTCATGCCCTAAATCCTTTCCCTTTGGGGCGTCACGA
TCGAATGGCAATCCTTTCTAGCCAGCGCACGATCGGCACGTGGCGACTTG
GATCGTGAGCTGATATTTTTCGCACTTTTTCCCGTGAATTTTGTCGGTAG
AAAGAGAAACGATATTTGATTTTAATCATTGATTTATTCTTTCACAATCT
TGATGTACAATTCGTAAATATGTGCAGTTTCTAGAATATTTGTTTCTGCA
ATCTAAACATTATTTATAATTAAGTTTTGTAGCATTTCTATTTGTAGCTG
TAGTATTCCCAGGGGTTCGAAAGTCAACGCATCTAGTCCAGAGGACTACT
TTGGACTTGTGTGGGGATCAGGGGAATGCGATCATCGGAGGCACTGCTAG
CTTTAGTGGGCATGACCAGTGGCTTTCAAGGATCTACCTAGATCTGCTGC
GACTGGGATTACCTCCACGATGAGATGGCCCAGTTTTCCATTCCCCGCTC
AAGTGATTTGGCAATTGACCTAACAATTGGGCTAAGCGCGGGAGGGAATC
TGAAAATCTGGGGATCTAGCCATCTAATCTTACGGATTTACGTGAAACTT
TTGCAATCGAACTGGCGGCCCCTGGAACTCGACCATTATTTTGCAATATA
CGAGCGGAGTGGCCTAATCTGGTGGACTGTGGACTGATCCCGATGCCGAT
CCCGTTCCCGATCCGCGATCTCGTCTCCTCGTTCGCTCGTAATCTGAGAT
TAAATTAAAATGTCGCAGGAAGGCGATGGGCGGTGGGCCTGTGCTGGACG
GACTCACCTCTGTTTGCGCTAAATCCCCGAGATCCAGAGGCCTAATCCTT
TCGCTCGACCGACTACCTGGCCCCTGATCCCGTGGCCCAGATCCCGAAAC
CATGCAACAGTCGCGCTACACACGAATTAACCTGATTAAAATTGTATTTT
TCCCAAATTTATGGGATTAAGTTCCGTTCAAGTTCCTTTAACTCGTTTAA
GCTACCGGATTTAGTTCAAGTGCTCGCCTGGATCTCCCCGGGAGATCTCA
GGCCATTCGGCCATCCGCCCCGGGCTCTCAGGCCACTCAGGCCGCTCGAG
CCTCTCAAGCCTCCGAGAGCCGATTTTTATTGGGCTGGCTTAATTAGCAC
AATTGTTTACAAATTTACCTTTCGTCATGCTGCAAGGGATTGTTCCAGGA
TCCTCCTGAGATCGGTGTGTGAAATCCATGGCCCGCACACGCCCACGGCT
CAAAATTCTCGGCCCAGAATCTAACGTCCTGCAATTCAGAGCAGGGCAGG
GCAGATCAGCTATGTGTGAACCGAGCAGATAGCAATTCCCCTTAAAATTG
GTCTAATCCAGAGCGTGGACCCTGCACTATGGTACGTCTTGGCCATCAGT
TCCACCAGCTCGTCGGCCCGTTTGTCAATCAATTATGAGCTTAATGCAAC
TCGTAATGAGTTTTTTTCTCTCAAAAACTTTATCCACACACCTTTGTGTG
CGCCTGCAAAAAAGGGACTCAAAGTTGTGTGAGAACCAAATTTCTGTAGA
GCGAAGGGAAATCTGTTTATTTCAATTGATTGCCAATTCATAATTTACCT
TATGCTTTCTTATGGATGTATCTGGTGTCCAGGGGAACTAGAGGCAGACT
TTCCAAATGTTTTTCAACCAAAAGAGTGACATTACAGTGCGGACTTCGAA
AACACACCCATTGACCTCGGCGAACGTGAGGCCACTTTGAGCAACTCCTT
TACTTCACTTCACTTCACTTCCGTTGGGCAGCTGTAAAGGCTTAAGAGGT
GCTCGATTGGCGCCTGGACAAGGATCCTGCGACTCCTCGAACTGCGTTCC
TGGCTGTGCTGTGTGCGTTCCCTAGAAGACGACACAAACTCTGTGCTTAG
GCAAATAAAAACAAATATTTATGAGTAAAAACAAACCCCAGACGAGGCCC
AAGGGCCTGTTGGCCGTAGAAAAACAAATCGTTTGTATGCCCTGTGGACC
AGGCAGAAACACGTGCCCACTTATTATATTTTCGTTGGATTCCAGTTCGG
GGCTGGAAGGCCAAACTAACTCGCCATTGATGCTGGAAAAACAAAACGCA
AGTCAAGCCATCGAAATGGATTTCGAATCGCGTTTCCCCGACATAAAGTT
GCAATATGTTGTGTGCGGCGGGATTAGAGCCAGAGCAATTTCGATCCTCC
GGCCGCAGTCCGAACTCCGATCCCATTCGGTCTACGCCCCCTCGAGATTA
ATGAGGATGTGTTTACTCCGTCATGTTCCCAGTCCAGAATGCAGAATTAA
GAGTCCAGGATCCAGAGTCCCAGAGTCCAAAGTCGAATCCTTTCACTAGC
CAGGGGCATGAGCCACATGTGTTCCTTTTTTCCAGCTGCTGACCACACTG
GGCACTGGGCATCGGACTTTGGTCATTGAGCATTGAACACCAAATACCGA
AAAAAGACCACTGAACACGCTCATTAGGCAGCCTTCCACTTAAGCGTGAG
TTGGCTCTTTTTGCATCTTTGATAAATTAACCAACAATGGGAGGCGAACT
GTCGCTCGTTGGCTCGTGTTGGTCTTCACTGCTCGGATTCTGTGACAGCA
TTTCCTTCGGGATGTGGCCAGCAGCCAGCTGAATAGCCACTACTTGGAGA
ATCGTATCTCGATTTCTATTCCCACTCACTCCACAATTACCCCAACCAAG
CAGTCTGACCACTAGAAATCTGCAGCACTCCGAATGGACTCCAATGATCT
CCAATTCAGCATTTGAGCTGAGATCCAGCAAATTCGAACTAATTGCTGCA
CCCAGAGCATAACCCAGTATCGATTCGTTTGCCACACTCCAAGGGAAAGG
ATCAAAGTCCGGGCTTCGTGGCAGGAGGCTGTTTGTCGAGGAACTTTCTT
TCCCGCAGTTCCTTTGAAGCGTTCCAGCTAACAATTAGTGAAGAAAGTCG
TGTGGCTCGTGCACCGAAACAATTCCGCAGCCAGCGGTCCTCAGTTCTCA
GTCCGCTTCTAATTATGCGTCGAAAAATTGAGCGCCTCAAATTACTCGTG
CAATCCGAACAAGAACGCAACATGAGCCTTGGCAATGTTAATGGAAATGC
AAATGCCATTGCCATCGCCATTGCCATTCAAGTTAATTAATCACGGCAAC
TTGTGGCAAATTGTATGCAAGGGGTATCCAAGGGTCGACCGGAACCGTAG
ATCATTAGGAGTTTAGCGTTTAGAGTGCTAAGATGGCGTGGCATATGTGA
GTGATCCTCCATTGTGTCCGGCGGATTGTTGGAAAACCCTAGCTAATGGT
CTGCGCTGACAGTCGAGACAATAAACGCGATGGATGTATATTTATATATG
GTCTAGTAGAGAAAAGGATTCCGGGGGACAGCGGGTCAGTTCCCAGGGAG
AGGAACTCTTTCCACGCTCCGCTGATCGCAGTATTTGTCTATTTGGCAAA
CAGACCTCGATCACGACAAAAAGATAATCGGCGAAGGGTAAGACAGGAAG
TGATCTGCTTTCTTCGCATCGTTTCCACTTGTCTGGCCACAAATTTGAGG
TTGCCTGACCAGATAATCTTATAATGTTGCTGCGCCACAGCAAAAGTCTT
CTCGAGTTTCCCCCGATTGTATTGACAAAACAGTTTCAGTATCAATGACA
GGATTTTCAGCCACGGCGAGGGGCAGGTGGTCACCGCATCGATTTAGCCA
GGAGTGGGGGGGCATAAAACCTAATTTCGAGTCAGCAACTAACTCCACAG
ACTCCCCATAAATGTGTCACATCGCGCCGAATTGATGGGATGTTCGTTCC
CCAAACTTCTACCCCACTCCAAACTCCAGACGTTCACGTCCACCCTGCTG
CGCCAAAAGAAACGCAGGAGGGGTTGAGACAACAATTGTAGGAAATTGCC
AAAAGTGACCACAGCGGCGGTCAGCATTCCGAGCGACCCGCAAAATTGCC
AGCGAGCAACCACTTGTAATCAAGCCAACGCCATCCGGTTTTGTTATCAT
TAAGCAACCGCCCGGGAAAGTCGGAAAAGGGCTTTCCCGAGCCGAACTAC
GCCGAGGCAGAACCCTTTCATTTGCCTTAATGAAAATGCCCCCGATGCTG
TCTATCTGTGTGTCTGTCTGTCGCCTGCTATTTATTTATTAAATGCAGGA
GACTCCCTCGCCTCCGGATGGACACAATGGACATCGGACAATGGACTGGG
TCAGCTGGCACAGCTGTCACATTTTCCCTAAGCCCTGGATCTCTGGATCC
GTCACCCACTCCCTGCACGTCCATCTCCATCCCCACCTCCACCTCCACCT
TCACCGCTTCCTCCAACTCCCTATATTCAGTACTATATCTCCAGGCTTTA
ATGAAGTTGCGGGGATTTATTGCCCAGAGAACCAGTTTCCCACCAAACGC
ACAAAATGAAGTCGCAGCGGCTTGTGGTGGTGGTTTTTCGAAATCCCCTC
CAGCTGTGGTTTCTGCCTCTGATTGGCCGAGCCTGCGAGCGAGCTCTACT
TTATTGCATGGCCCGGAGTTCGGCAGAGTCTTCGATTTCGTAGCAGGACC
TCGATTATAAACGCCAAAATGGCGCAATCCCTGGCAATGGAGGATGTAAC
GTAACATGGCGACGGAACTGAATTATGCGACCTTGAGACAAGTTCTAGTT
CAGAAGATTAACTTTAGGTCCTTTTCTAAAATCCCGTCATTTTTTGGACA
CAACTTTCAGTGATCTACGGAATGGTAAACTGTCCAAACAGTAAGAAATC
AGCAATATAGTAAGAATAGTTTTGTCAAGCTTAGCTTACTTAACTCTAGT
TCCTTACTTGCCAGTTTTTAGCCACATTTTTCGACCTTTTTGATTCCCCT
GCATTACGTCAAACGTATTACTGTTGCGACCAGGCTCAGAGAAATCTGTT
CGTTGAGCCTAGCTCGACAGTTAGTCAAGTCATCTAGAATCCATTGCCGG
CTTAAAAGTGGAGAGCTGCGGATCTGGACACTTGTTTTCAGGGGATTACG
CTGTTCGGAACACGCAATATTATGCGAGATTAACTTGAGGCAGCCAGATA
GTCAGGATTAGCATGGAGGATTGGAGGATCGAGAGAGCTGTACCTGGTCA
CCTGTCGGATCACCCGGAACCCTACGGCCCACTGAGCTTCCAACAATATT
TGTGTTCTCCTTCCGAGAAGCAAAAAATGCACTTTTAAAGATGAAACTGA
AAATTATGAAATGATATGCTAGTTCATATTTTTGACAGAACTCGGTGACA
ATGGCACATTTTGCCACCTACAAAACTGCGTGCACAAAGGGCTTAAACCG
CTTAAAGACCGTTTAATCTCATGGATTTCAGTCGTTTTTAGTTTCATGTG
AAAAAACTCGAGGCAAAAGGCAACTGTGCTTCTCAAAGGAGATGAGTACA
GAACGGAACGGAACTCGGATACAATGGGCGTGGCCGGGTCGAAGACTTTA
CGGGGTTAAATGCTCATATTACGAGCTGGCCAGGAGTCACTCTATGAAAA
AGAGTTATGCGGAATGAGGCTTAGGACCTCATTGAGTTCCGTTCAGTTCA
GTTCCGTTCTCTGTTCCAGGATTTCCTCCGATCTACCGTTCTCGCCCGGT
CCCTAACTGCCGATCCCGATTGTATCTGGGCAGCGCATCCGTTCCGCTGG
AGATCGTGCTGGATGGATATGCTTTATATGCTGATGGCAGTTAAGAGATG
GTGCGAACTGACAATTGACACAATTACCAGGACGGCCAAATCCGCAAATC
GCTGCAATGCCATTTTGACAGCAATTGTCCTGGCCAACAATGTGATCTGG
GATCTGGAATTTTGAATTTCGCTTCTCGAGAGGAAGGGGGCTAACAGTAG
CCATTCTAACGGGGTTTCGTAGGCGGCTTTGGCTTGCATTTGAACAATGG
CAAAAGGACAAAAAGGAGTGCAGCAGCAAGGACACTCCCGCAAAAAGGTG
TGAAAATTTCAAGGGCCGCTTGATAGATCGAGTGGGCTCGAAATCCCGAT
GGTCGGGGGCGGATCATAACTCTTTTTATGTGGGCTCTTCGAACGGCGGT
TTGATTAACTCCGGAAAAACCCCTAACGGTGCTCGGCCGCTGACAATGGG
CGTCGTGGCTGATGGCAGCTAATCAACAGTAAAATGCATAAAATTAAGTG
AGCATTGAAAGGGCATTATCGGGAATAAGGGTCTTTGCGCCGGCTATTAG
AATTGTTTCACACTTTCCGCACATAACTGTACCGCAAGCGGTTCTCACCC
AAATAGATACCGATCTCAGTGCTCCGAGTTGGAACAATGGCCCAAAACGT
TGACAGTTCATCAAAACGAATGATGCATGCAAAATGAATGTGCCATCAGT
GATCAGTGGCGAATACCCCTGCAATCGCTGCTCAGCAGCAGTGTCTGGTG
CACTGGAAAAGAGGTTTGTCAAAACTTTGTCACTTAAGTATTCATGTTCA
GATTAATGGTCCTTTCAAATTATCGCAGTGTAGCCGTAGGAGCAGAGATC
TCCCACTCGGAAATCATGCGTGAAATGTTGCTTTCTTTGGATTCCTTTCT
TTTGCTCGTCTTGTGTGTGCGAGTATTTCAGTATTTTCCCAACCCGAGCA
TTCTCATTTTCCTGTGACTATGGCGATGGGCGTGGACACGGACACACCCC
TCTATCCCCTGTATCCTGGCCATCTTCCTGGGGTCCTGACAACGGGACAA
CGGGACAACAGGCACAATGATGGCGTAAGGAAGTAGCAAGTTAGTTTTGC
CCATTTAAATTGCACTCTGGACACCGAGCTCTTTGTGCGTCGATTTGACG
AGCATTAAATGACACTTTTTCCGTGTGGGGTCCCCCCATCGATCAATCGA
TCGACCCAATCTTGAGTCAGAACCTTGAACTTATCGCGCACAATTTCAAT
ATTTGGCATTCGCAGCTCCACGCACTCGATCATTCAAAGTTCATTGAGTT
GCTGGGATGTTTGGCCGGTGCAAACTTAAGATAGTAATACGATAGACGCG
ATGTCGCCCCAATTTGGAAGATGCAACTTGCTCGGCAGATAAGAGGACTC
CAAAGAATTGCGGGTCTGCAAGGCCAATGTCATTTGGGTAATCAAAACCG
CACTAATTGGCATAGTAATGCAATACTGCTTTTGAATTTGGGATCCGGAT
TTCATATTCCGGACTTGAGATCTGCTCGAGATCTTTTCGCTTGGCTGGTC
AGCGGTGAATGAAGTAAGGCTCTATTCGAAGCGGCTCGACGTCTCTCAAT
TAAAGAGATGCCATAATTGAGCAGCCTTTTGCTGGACGTGGGATTAGGAG
CCATAGGATAACAATTAGCCAAAGGATTTGACGACGGAAGCTATGGCCAT
TGTGGGTTCCCTTCGAGTACTTAACTTGTGTCTTTTTTTAGTCGGGGTTC
TTTTTGCCGAGCTGTGCACTTCCGTTTGCGGAAGTGGCTAAGGCAAATCC
CCAGACACATCGAGCCGAGCAATACCTGTTCCCATTATCCTCTGCAAGTG
TGCACTTTGCATATGCCAAGGAAAACAAACAAGTGATCCCAAGTCCTCGA
TTCTCGATTTCCGACTCTCGATCCTGGTTAGTCTTTTTCGCTTAGCCCAA
ACACTCTGCTGCGAGAGGAGAGTGCCTTTGTCCGGCCGAGGAGCACGTGT
AATCCCCGTTCACTTCCTCGCCGGCCGACTACTTACTTCCTCATTAGCAT
CGCAGGATATAGGTGCCTTTCCTGATGGGCTTAGACGGCCATCGTGGCCG
AGAATCAACTGAATGACGGCCAAACTAATCATACATTTGAAAGTAATCTC
ATTTCATCAATTGTGCTGAAGAACGGCCTTTCAAGGAGTTCCTTTGGGAG
GAAGTTGGCATTATCTTGCAAGAATTGATGATATGAAAAAGATAATTTAT
TACCAGAAACTTACCATCACTTCGAGATGAAAGTGCGGAGGAGAGCGCTG
ATCTTTGCTTATCCCAAACTAGGGGTTTTTTAGGGGTAAAAAGCGGGAAT
ACAGATTCTCAGAAACAAAATGGCAGTCCTAATATGTGATAAGTTGCTTT
CAACTTACGTTTACGACAGGGGCCATTCGAAGCTAAGGATTCCAATATGC
GACTGTTAACCCATTAAGACAAAGGGCCGCGAAAGGAGTTAACGGCAATT
CCCCGAAACCAAGCACGAATCCAAATCCAAACCACTCCTCACCCTTTTTT
GGACGGGTGGGACGGGTCATATAAGGCAAAACCCCTTTCAGTCAATTAGT
CGCTGATTTTCTTTGTCACCTAGCAGCGGACCAATATAAAAATCGCAGCC
ACAATGGTCGGAGGAGAGAACCCTTTTTTTTTTAAGGACCGCCGGTGTCC
GAAATATCAGTTTATGGCTCCTTAAAAAACTGCAGCGGTTTTAGGGCCCG
CGGACTCGGAATGAGGCCTTTTCGCACGAAGCGTCCATTATGCAATAAAA
CTTTGGATGTTTTTTAGGCAACAGCATAACAGCCTAATACAGCGCATACC
GTGGGTGGGCAACCCGTTCGGCCATCAGGTAGATGATTCCGTAAAAAACG
CGCCCAAGGTCACAACTCAAAGGATTGCACAAATATTGCATCTTTGGTTC
GGAGCTCATTATGGCGAAGGAACAGCAGTCCGAGTATATGAATATATGGT
TTTATGGCCTGCTGTTTTTTACGTTTTTTTTTCGCTGAATCTGGTTTTTA
CACCGAACTTGGCAACTCTTTGGCTTCGACTTCGGCCGCGACTTTTTATG
GCATCTGCTCGGGATCGATTGGGCTGGGCTATACGTATGTCCAGGATCTG
GAAGGGCTCGGGTTCGGGCCCGGTAACCGCAGGTAAGGGATCGACTCAAT
GACGGCGACGTGACGGTCCGAGTTTTAGTTTAATCCACCATTTTTACGGT
TGGATTAGCGCACGGATTAGCGGATAAGTTCGCGGTTTTTTACTGATTAC
CATCGATCGATCCCTCTTTTTATTTGCAATTCACCCAATCCCCCTGAATG
GGCAGTTGTAAAAAGAGAATGAATGAAAGATAGTATATAATGTAGGTATT
GTTGATAGGATTTGATAACATTTCAGCGTAACAAATCTAAACTACGTTAT
GTCCTCGAATTAGCTGCAGTAAGTATCTAGCATAACATTTCCCATGGATG
ATAGCCAACTTTGTACCGCTACCCACTTCCGTTGGCTGTCGAGGCGACCG
TTAGGACAAACAGTTAACAAAGTGAAACAACTTGTCGAGGATCCCACATC
CCACGCCGCAGCGGAAGCCAAAGGGATAAAGGACGTAGAATCAAGGATGT
TTAAGGAGGAGGGCAAACACGAGCAGTCAACACGGACGGCCACTTGTCGC
AATGATCCTGGACTCTCGATTCTCGATCCTCGGGCTGGCGGCGTCATGAA
TCAAATGGGCAGACTGGCGAGTGTCCTTGCCAAAATTCCGGGAAGCCGAG
TTTTCATTGCCGAAATAAGAAAAGGATGCGAATTACGCCAGCCGAAAAGG
GCTGAAAATTGCAAGAACGCCAGAACTCGTCCTAATTTCCATAATTTGTC
ACGCACAATCCAACGAATTCGCCATCGCATGGATACACAGATTCTAGATG
GGCTGGTCAGCAAAAGGATTTCGAAACAAAAGCGCAAAACAAACGGATTT
AGCCATCACAACCCTTGGATGTTGTGCATCTATTATCAACAAACTAGATT
CCATCTCTTTTCTTCTGCCAGATGCCTCTCTTTCTGGCCAGAAAAGTATG
ATTTGAGTGTAATTATAATAGTCTACGGTCGGGGGGTCTTTGATATGCGA
AATGTTCTAGAAGATTCAGAAGTATGGTTTATTTCAGTGCTGAAGAGAAT
AGCCTACGATGTTTAATTGCGGTTTATTCTTTATATTTGAAAGCAATATA
TACAGCAGTTACTTAAATCTAAAGGTTTAATAACTTAAGATTTTTAAGAT
TGGTTTTTGGGTAAGGGTTTTATCAGTTGGATGTCAAAGCAAGTAAGTTA
GGTACAATTGTAATAAAAAATCAAATGCACAATGCTGGTATATACAAAAA
TCTGGGGTTTCCTCAAACTTGGACTTATAACATCGCAATGAACGCCTATG
AAAATAGAGCCGAAGTTTATAACTCTATATTGATTATGAATATTTTTAAC
CAATTCCATGAAAACGAAATGTAAAGCACTGCAGAGGTGGTACGAATTTT
CCTATTTTTTCCCATTGAATATTAAAACCAAGAAAAAACCATATCCTTTC
GCGGAAACTGATGAAACGTAAAGTTCGAAAACTCTTTGTACTTTCTTTTT
AAAATTACGTTAAATGGCGAACTAACAATAGCACAAAGAACTATGATTTT
TGCGAAAACTGCGAAAACCAAATGAGGGAAAGGGCAGCCGCACCCTTGTA
AAACCCTTTCGAAAGCGGTGAGACAGAGAGGGCAACAGGCCAGAGCGGGA
CAGAGTCAGAAGCAAAGCCAGAATCACCCCTTTGCCCTTTGGCCTTTGTA
CCGCCTACCTGCTTCGTACCGCTTCGGCTGGCCGCTCGTGTCCGCCATTT
CGATGTGAATGAGGCGTCGGCGCAGCCTCCGGATTTTCGGTATAAATGCA
GGGGGTTCCGACGAGAGGAAATCAGTTTGCGTTCGACATCGTCAGCGTGA
AGATATAGCAACATCAGAGCTAGATCACCAGTCTATATAGCGTCAATCAG
TTGGATTAAACCCAGAGACCATACACCGAACACCATGCTAATGCACGAGA
AACTCATGGCCGGGCAGTTCTTCGATCTCAAGACTGGTAAGTTGGCCACG
CCCCTTGGTTTCTCCTCGATCCGTAAACTAACAAATCCCCTCTCTCTCTC
AATCTTTGCAGATCGCAAGCCCCTGATGCACCACCACCAGTACCAGCACC
ACCAGCAGCAACCACTGCACCACTTGCCGCACAGCCAATTGCCGGTTCAG
GGATCCTTGGGCCTACCCAAAATGGATCTGTACACGGCCTACGCCTACCA
GCAGCAGTTGCTGGGAGCTGCCCTCAGTCAGCAGCAACAACAGCAACAGC
AGCAGCAGCAACATCAGCAGCTGCAGCAGCAGCATACCTCCTCTGCAGAG
GTCCTGGATCTTTCCCGTCGATGTGACAGCGTAGAGACACCCAGGAAGAC
TCCCTCGCCGTATCAAACAAGCTATAGCTACGGCAGTGGTTCCCCCTCGG
CTTCGCCCACCAGCAATCTTCTGTATGCCGCCCAAATGCAACAGCAGCAA
CATCAGCAGCAACAACAGCAACAGCAGCAGCAGCAACAATTAGCCTCCCT
GTATCCCGCTTTTTACTACAGCAACATCAAGCAGGAGCAAGCCACGCCCA
CTGCTGCTCCGCCCAAGGTTACACCAACCGCTAACCTTCTGCAAACCTTT
GCTGCCGCCTCTGCTGCGGCCGCCGCTGCTGCTGCCGCTTCTTCGACCAA
CTCACCAAGACCCGCCAGCAACGCCAGCACCATGCAGATAGACGTTCTGG
AGAATCCCCTGTCACCGGCTGTTGAGGCCACCACGCCAACCACCTCCAGC
AGCGGCGAGGCGGGAAAGAACACCCGTCCCTTCAAGGCCTTTCCCCGGGA
TCCCTTGGTCATAGCTGCCAATTTCGCAGCCACTGATGTCCTTTTGGACA
ATCCGCGAGTGGAGCGCTACACGGAATACCGGAAGCGAGTGCTTGAGCAA
ATCCGCAGCTCCAACGGAGGATCGCGCACCGTAACCAACCCAAAAATGCG
AAGGACCAACTCAAGAAGTGGATCCGTCAACGAAGGCAGCTCCTCAAACA
ACAACAGCGAAAGCGAGGATCGCGCTGCTGCGGAGGAGTCAAGCGACTGT
GACTCCCAGGCGGGCAACTTCGAGAGCAAGTCCGCCACCAGCAGCTCCAG
CAACTTGGCTAACGCTACTGCAGCAAACTCGGGCATCAGCTCGGGCAGCC
AGGTTAAGGATGCCGCATACTACGAGAGGCGTCGCAAGAACAATGCTGCC
GCCAAGAAGTCCCGCGATCGCCGCCGCATCAAGGAGGATGAGATCGCCAT
CAGGGCCGCCTATCTGGAACGCCAGAACATCGAGCTCTTGTGCCAGATCG
ACGCCCTCAAGGTCCAGCTGGCCGCCTTCACCTCCGCCAAAGTAACCACC
GCCTAAAGGTCCACTCCTCTCTTGATGCGTTGAACGCGAGGATCCGAATC
GTATGTCCAGTTTTTGGGTCAGCTTATCTGTGAATAGTTTAGGGGGCTCA
ACTTTCTTTTTTTTTTACACGCTCGCATTTAAGTACTTTAAGTCCTTGGA
GTATACGTTATATTTGGAAAATGTATTAGCTGTAGTGCATCTCGCAATCC
CACCAGTTAACTATCAATGGAATCATCTATAGTTGTAGAAGTCCCAGCTA
GCTATTAATGTTTAACTTATAAGTGAATTTTTTTCATAGCCCTAAGGAAT
GAATTTCAATAAATTATCGAAAATAATTATCTCCTGGAATTTCTGTTCTC
GTTGGTCGCCTCCTGGAACTCCTGTTCGCCTGGTAATTTAAACCGAAAAT
CTGTTAATTTTGCTTACAAAATTAGCATTTTTGTGGCAAATTTTGGGATT
TTTGGTACCAGGCCAACATACTCAGTAGCGGGTGTCTACTGAAAACCAAC
TAATCGTTGGTCGCCTCCTGGAATTCCTGTTCGCCTGGTAATTTAAGCCG
AAAATCTGTTAATTTTGCTTACAAAATTAGCATTTTAGTGGCAAATTTTG
GATTTTTGGTACCAGGCCAACATACTCAGTAGCGGGTGTCTACTGAAAAC
CAACTAATCGTTGGTCGCCTCCTGGAATTCCTGTTCGCCTGGTAATTTAA
GCCGAAAATCTGTTAATTTTGCTTACAAAATTAGCATTTTAGTGGCAAAT
TTTGGATTTTTGGTACCAGGCCAACATACTCAGTAGCGGGTGTCTACTGA
AAACCAACTAATCGTTGGTCGCCTCCTGGAATTCCTGTTCGCCTGGTAAT
TTAAACCGAAAATCTCTAAATTTTGCTTACAAAATTAGCATTTTAGTGGC
AAATTTTGGATTTTTGGTACCAGGCCAACATACTCAGTAGCGGGTGTCTA
CTGAAAACCAACTCAAAAACAATAAAACACCTTTTTTTAGGGTTTAAATC
ATTTATTTTTATTCATTAGGAATCGTTCAGTTCCTTCTGAACTTAACTTA
ATGTGTAGCTTAAAAGATATTATGGATTTTTTCCTTAATTATAGTGTATA
AATATGTACCGTGGAGAGATTATACTATCTTACGTGTAAGAATTCATGGG
AATGTATTCTCTTCAGACGTCGGAGGAAAATAGGGTCGACTAGATTATTC
GCCGACGTGTTCGGGTGGGCGCTAAGCCTGTTGGCATATCGACTGCTGTG
GAAGTTTATTTGGTCTCCCAATGGGACAACTTTTAAGTCCCTTTCAAGAA
CTCCGTTGGTCACATACCAGGGTAGCCCAGATGCATGTCGTGCCGCTCGC
GATTGTATTACTCTAAGCCTATTGAGCTGAGTCTTAGAGGCTATTCCCCA
CACTTGGATGGCGTAGGTCAGTGTTGGATCTATAATAATAAATATAATAA
AAAAAAATCTAAGAAGAAGTGTATTGAAAAGGTGTTAGATCCAAGTAAAC
TTTTAAAATATGAATTTCCAAAACAGTTTAAATTGAAACATCCAAATCAA
GGCAACTTTTAAACTAAACTCAACCCATTTTGTATATAACGCTTGTCGAA
ATATCGGAATCTGTATAACGAAGTGGCAAGGAGAACAGAAAGGGCTTAGC
TTAACTGGAGTAAAAGAGATAAATGAACAGACTGATTAAAAATACATAAC
G