P[acman] BAC CH321-90J08

CH321-90J08 is on chromosome arm chr2R from 9589247 to 9677247.

BACPAC Resources is the distributor of clones for this project. Investigators requesting a clone will need to establish an account with them. They will also respond to all questions regarding shipment and availability.

Return to the Browser

The sequence for the BAC is deduced by extracting the sequence from the reference genome based on the alignment of one end of the BAC and the estimated location of the other end based on mean insert size from the library. The sequence of the BAC has not been confirmed over its full length, nor has the sequence been aligned to the MboI restriction sites (GATC) used in the BAC library construction.

>CH321-90J08 88001bp
GATCTCAGAAATGCCATCTTCCTTGCAATTACACGGCGTCGAAATGAAAA
CGTGCTCGCTTAAGCTAATGTATACAAAGGCGGGTAAATAGGAAGCATTA
CGGTTTTTATACGTTTGAATTATATACTTAATTAATCTGTACTGAAAACA
CAAAAAAGCGCATCGAAAAGAAAACACTCAGCTGGGCGATAAGCCTGCAA
GCAGAACATCATGTACAGTAGCCCGCCGATCTCAATTGTTGTTGTCGTAT
TTATTAATTTAATGTGCCATTGATTGATTTTTAATGTCATTCGGGGGATG
GGAAATTCAGAGACAGGAATAAAGAGAATGTGGAGATTGAAGTGTTATCG
TCTGGCCGACCCACGCGGCGTATGATTGATGCATTTATGTTGATTTTCTT
TCGCTTTCCGCTGCTTTTTTCGTTGTCTCACTGCATTTTATGCATCATTA
TGGCTGCGTACCCAAAAATATGAGACATTTGTTGTGCATACACAATTTCT
GACAGTCTGCCTGCCAACCAGCGCTCAAACTCAATCTGCATGCACATTAG
CCGATGGAACGCCAACGCGGATACGGATGCGGATGCGGACTCCAGCGCTG
ACATCCGTACGGACGACCAGTCCTCTATAATCTTTCAGCAACATTCATAC
TTATGGTATTTACATTTACTGAGCTGTCCCCAATTTTGGTTAACAGTTTC
CATGATTCATTTCCGCAAAGAGGTGAATAAAGGACAAATTCCAGGTCGAA
AAATCCGATAGCTCATATTTTAATTGACAGAAAAAGTATCTGAAAGATAA
TGTAGGTATATTTTTTGGGTTTGGATATTTAATAAGTTATTGAACGATAT
AAATATAGTGGCTGTAATGCTTAAATATATTACCATAATGATTTTATGTC
ATAATATATAAAGCTTAAATATATTACCATAATGATTTTATGTCTTGATA
CTAATAACTCATACCAACTAATTATAATTATTAAAGTTCGAGAAAAGGTT
TAGCTTGGTGGCTTTTTGAGCATTAAAGCAGAGCAATCAGTGATTTTCTA
AACAGTCATGAATTTATGCTTTTACCACTCGAGCATATCACTCAAATAAG
TGCTGAGAAGCGAATAATGCATTATCGGAATTGCACAATCATTGTGGGGG
GAGTTTCAGCTTTATCTGTTTTGCATTTCACTTACGCAGAGCCCGAGGAG
GACTAAAAGATACACTCGGGGTGAAGCGCTGAAAGGAGCTGAAAGACCAA
AAAGATCCGGACGGACGTCCAGCCATTAGGAGAAACACATGCATTCACAC
TCAAAACCCGCATGCAGATTTGTTTCCAACGGTCTATAATGGCAGGAAGA
ATAAAAGCGCAATAAATCCAAGAGGTTGGCGCTGGCAAAGGTGGAAGTGC
ATAAATAAATATATATGTATAGCCCAAGCCAGAAATTCGTTGGTGGATTT
GCTGGAGTTCTAAGAGCGCCACGAAAAGCTGCACAGAGTAGAAAAACATA
AACAGAATATAAAACAATTGGATTGACCCAGATTCATTCCTGCCGCCTGT
TCTTTTTTTCTTTTCTTGTTCGTTTTTCGATTTTGGGTTTTGTGCTTGTA
TTAATTATCACATTTTTGTGCCACGACGCGCGCCTTTGATTGCAGCAGCA
CAAAAAACAAAAAAAAACATCAACAATCGGGACCATATAGAAAGCATTTA
TTTTCGATTTATTTATTTTGGCTTGGCATGATTTGGGGGAATCCAAATGC
CGAGGAGCACGCGAGATAACGGCAGTTGTTAAGCCCCAGCGAGGGGTATA
CCCATATGTACGTATAGCCCAAAAGATTCTACCCAGGAACCGCCAAATCG
AGCAGCCTCGGAATGAAAAATCTTTGACATTTTGGCAGAAGGCAACGGCA
GAACGGTAGAACGGCGAACCGGCGAAGTCTTGATTCCTTGACTTGATTTT
AATGATGCACATGATGTCGCAGCTGCTTGGCCTGGCCTTTTCCGGAGAAA
CATCCAACCACTGACATCCAGCAAACAGCTACGAGCAACCAGCACCAAGC
AACAATGGCAATGACAACGCCTTTTTTGGGCGACATTTGTGCAGCGAGCA
GGTTTCCTTTTAAGCGCTGAATGTGCCATCAATTATGCGGCATGTTGCCG
ACCGGAGGCTTTAGCTTCAGCTCGGGATCCAGCTGCACTTACAACTCGGC
TTCAACCTGGCTTCAATACGGCTCCAAACTCCAAAGCCAAAGAAGGTACG
AAAGGAACAACATGACACACATGTAGGTGTTGCAACGCGTGTGTCAGTCA
TTCGGATACACTGAAAAAAATCCCATAATTTTCGCTTAGCATTAAAAATT
TCTTAATAAATATATGTAAAGGATATTAATTTATTCATTATAAGGTGTCC
CAAGCTGGGTTAGAAAATAGAAATAGCATTAGTTCTAAAGGTCTTTGAAC
CCTTTTTCATATTTAATGAAGACACTTAACTGCCTGCATAAAAATGTCTA
CCTTTTGAGTCATGCTTTTTTTGGCCGTGTGAATTGTCTGCTTACCTGAT
GGCCACCAATCATTTAAGCCCATATTTCTGAGTCAGCGACATTCCCTTGA
AGCTCTTTCTCATCCCAGTCTCATCATTCCCAGCTTCCAAAGTGCACAAA
TATTGACCAACTCATTTAGCCGTTCGGGGGTTTTGTTTTTCCGCTTAGCC
ACCTAATTTTGCCACACTCATCAGCTACACTCAGCTAATTTCATCAAACG
GTAGTCGTGATATGGTCAAAACGGGTTTCAACGAGTGCCGCAAGATTTAT
ACACATATGCAGCCTGAGATACTGACGATGGTTATCCATATAGCTAGGTT
GGTCAAAATAATAACAGTTCGCAGCAGGTTTCTGGCCTTATTTATGTAAC
ACTAACTACACAATTGGCGCCATACGACCAGTAGCACTGCTGACGATAAT
ATCTCGTCTCAGTCCATGTAAAATACTTTTAAATGGACTTTGCATTCCAG
TGGGAGACTAGGAAATTGAATCCGAAGAAATCAGATTTCCCTAGCGAATG
TTTCCAAATGCACAATTTGGACAAAGTTAAGTAAAAAATTACCAATAAAA
TCAGATTTAGTATTTCCTGACTGATATTTGGTACTGAATTGTTTTATTGC
CCATGTAGCTGGATTGAAGATATTTAGATTTTTTTTACGTTTCGGCTGTT
TAATATTTCAAAATGTTTATTACTATAATTCTCCTTCAATAGCACTCTCC
ACCTCTTTTTTATGTCCCCACCTTAAGATGGTTGTTTGAGCCGCTGCCGC
TGACCAATGAAATGAAGTTGGCTAAAATATGGCACCCTCAATTGAATTAT
TAAGCGAATTTATGCACTATCCCCTGAAAGCAGAAAGCTGACTCGAAACG
ACGGGGCGTGCGGAGGATTCCGACCGTATATCACCGACCATATCGAGTTG
CGTCGTCTGCAAACGGTCTTAATGTCATCAGTTAAAACCTTTTAGCCTGG
CTGGTTGCAGTCTTTGCATACGAGTGTAATTGGCTATAGCCATATGGCTG
GCCGGCCATATATGCGGCAGCTATTTCAGGTCTTCGATCTCAAGGCGTTA
CATGTCCACACATCGATTTCTGTTTATTTAACTGTCATGCCAAGTCATTG
AACGCAAACTTGGATGCTTTGTTATTGAACAGTGCGGAACAGAGCGTTGT
TGCGTTGATATAAATAATGATTTATTTGTTTATTGCAAATTGCTCTCGGA
CACAAAGCGTAGTTAATCAAGAGTGCAGTTTGCCTTGGCGTCCACACTCT
TTGCCATTTCCATTTCCATTCTCATTTTCATCTACCCATCTTTGCTATTT
ACGCCGCCTCTTCGGGGGATTGGACCTATTGTCTGGAGCGATTGAGGCGT
GTATAGACTGATTGGGAACGGAATGATTGAGGTTGAGGTTTTGATGGTGC
GGAGGTGGAGTGGGGTTCGGACGCCTTTGATGACTTGTTGCTCGAACGCG
GCGACAAAGTAAACGCTCCTCGAGCCTCGAGAACCTGGCGGCTGGCAAGT
GGCGAGTATCTCATCACTTTCCCATAAACTCCGGGCCCCAGATGGGGCTG
CCAGTGGGCCGTGGGCGGGGATATTGCAATTTACGTCCTGTGGTCTAATT
AAAGTGCAAGCACAAATACAAACACAAACACAAGCACCAGCGGCAAACGG
CCAACTGCCAACTGAACTTGTGGCAGGTTGAAAGACGGACCACGAGCTAT
TCGCCAGGCGCATTGAACGTTGCGTGTTTGCAGCTTTGCGGTGGGTTCAT
TTGATGGACTACACGGTGAGAAAAAATGTGTTAACTAATTTTGAAAAGTG
CCGGCACAAAAACATGTATGTACGTCTAAGATGGATGTACTTCGAGCTGG
TTGCTTAAGTGAAGGCAGTAGTGAGAATAAATTGTGAAAGTCCTTGCTAA
TTGGCCACCCCCTTTTTTCCTCTGCACTGGCGACGATGGGGCCAACAAAG
CAACTTTCAATAATATAGTATCCAACCCTATCTCTTCGCTCTTTCCTTTG
GCTTCGTTGCCTTTCTTATCCCACATTAATCAATGTTGATTTCAATTAAT
TTAACCATCTCTTCACTTTGTCCAGCCTTTCGAAGGGAGTGCGTGGGTGG
GTGTGTGTCTTTTTTATTAAATGTTTGCCGTGGTGGGCGTGGCCATCACT
CGAGCCGCTAGCTGGCACATCCTTTTTATTAAAATTCGCAGTCTATAAAT
TGCTAAGGAGCCCATGTGGGATGGGCGGGCGTAGGATTCCAATGGCCATG
GGACTGCGATGAGCGGAGGAAATGGGGTATGACTGGCGTACATGTTTCAA
AAGACGTGTGTGTACCCAAGACTTTTATGAGACAGCAACAGGAAATGCAT
GGAAATGGTCTGGGCTGGGCCGCCCGCCGAGTAAGGGGAACGTGTGTTTC
TCCAAATGGAGCAGGTCAAAAAAAGAATGTGGAAGTCCGAAGAATGATTC
AGAAACAGAAAATATACGAATAATTATTACAAAATCTGCCTTGCATATAA
TTACTTATAACTTTGCACTAGTTGCATTAAAAAATGAAAGATAGTACGAC
GAAGTTTTTAAGCCCTCGCATTTACAAGCACATCTTTGTTTGATAAAGTT
ACTCGTTAAAGTAAGTAGTTCAAGTACTAAATATTTTAGACGAGAGGCTA
TTTACGTTTTAATACCTATCTAGAACCGGCTTCAAATTGTATATTTCCAT
GCTATGCAAACGTGCCACAAAATGTGGATGATGATGATTCAGACCTGATT
CAATATCATTTCCAATGCGAATGCAATAAAGCCATTAATATTATTGATTT
GGAAACCATTTCACATACTCACTTGCAGTAAATTTGTTTGTGGCAAGGAC
CTGTTGTCCTGGCGACACATTTAGGTCCATATCCTGGCAATTTGGCCTCG
ATTTCATGCTCTTTGTGGTCTCTCAATCTCTAGATGCCTGCTCCATCTGC
TTTCTTTCTTGCTCCTTTGCGCATTTCGCAGAATTTGTGGCAGGATCTCA
GGCTATGTCCTTCTGGGCAGGCGGAGAATGCATGTGTTTCGAAGGAGCAA
GGAGGGCTTAGATGGATGCGCTCGTTTGTTGCAGTTGCCTGTCATTTTTA
TTGCTTTGTTTGCCTGCCGAACCGGCGTCATTTGTAGGTGGTTTTTATTA
GCCACTGTCGCATGTGGAGCACTGAGATATGGCCAGCGTTTGAGCCATTA
TGATTTGTTTTTGCGGTTTCCAAAGTCCTAAGAAGCAGTTCGAAAACTTG
TGATTTTTAAATAAAACTTTGAAGGTACTTTTTTGTATGTGTAGCGCTAT
AATCTGTTGCAAAGTGCAATTCATTACATTCTTAATACTCTTAAATACCC
TTACACAAGACTTCCACTTATTTAACTCACCCAATTTCTTACCTTATGAG
TTTAATTACTTTTAGTTTTTGCCTTGACCCCACTACACTTTCTGTATCCA
AGCCCTTTCCCCATTAATGAAGAGCACACACTCGCTACGGAATTAATTGA
ATTAGGCGCCCGGATAAGGCCTTTATTTTTATTTCTGTGCGACCCGCGCT
CGTATAATTATAATCCAATAAAATAATAAACATATCGCCTCGTCCGTCGT
TCAATTTACTTTCACACTTTCACCATTTCACCAGCAGGCGGTGGCGAGAA
GTTTTCCTTGAGACACGCCAACTTAACTAAATTAAGCCCCACAATTATTG
GATGGCAGTGTGGAAAAGCCTTATAACCATAACCACTCGCACCTTGCCCC
ATTCCCCATGCCCCATGCCCCATGCCCCATGACCCCCCCTTTGTCCAGCC
ATTCGCACTTTTCTCAATTGTTTTTCGTTATTGCTGTTCGTTATTATATT
TTGATAACATGATTTTGTTTACACGACAAATACTCACGTAGCAATGTTTT
ACTGTTATTGTTTCTGATTCTGATACGCTGCTCACCTCTGCTCCACGACT
TTTCCACTCCACTGGCGCTTTTCTATTAGTCAGAATCATGGCTTGGCCAC
GTACGTAGACCCACCGTCACTTGCCCGCTTTTCCCCCGATTTTCAAACAC
GTAGACCGGGCCACAAATTTCCCATTAAAAACGCAAAAGGCCAATGCATA
AATGATTGATACCGAAAGTGGGGGTGGTCTTGGGGGATGGGGTATGGGGG
AACGCTGTTTAGAAGCGCTGGAGGGGGTCAAATGTGAGCACTTCCGTCGC
TCGAAGACTAGCAATTCATTCATATACCCATCCATTCATAACTACGAATT
ATAGTTTATTGTCGTCGTAAAATGCTCGCTTCTCTGCCATTTGGCACACC
TTTTCTAAGTACTGTTTACAGCCCGCAAAGCCTTCGATTAGCCAAATTGA
CTAGTTGCGTCGGTTCGAAAGGAACCAGGCTCCACCGATTCCCTCCATTA
TCCAGCTCCTCGATGGACGGGTCTTCCATTCATTAAAGAAACTTGAGGCG
TCTGCCGGTGTCTCCGCTGGCCAGACATTCGGCTTCCGCTGTGTGCCACA
TTAGTCTTATCCCCACCCACAGATTAAACAGGCAGGACCGACTATAGCGA
ACTTTACAAAAATATTAACGATAAAAGGAACTACAAATATTCAAAAAAAA
AATTGTTCTTTACATTGTAGTTTATTATTTGATGTATTTTATCTTACAAT
CTAGAATGGCACATTATTAAACAATTAAGTATTAAGTGTTATTAAGTAAT
TTTTACCATTTCTTTATTCAAATCTAAAAGTAAAACATCTTGACAGTTGT
CTTATGGGGTTTCCACTGTATTTGCAATTCGCCTTTGCATTTCAAGCAAC
ATACACTTATTAATTGATATTGTTTTCGTGTAGCCGAAGGGGAGGGGTTT
GGGGCTGATACAGATGGGGCATAAAGACAGTGGCGGAGACAGAGAATTCC
ACATAGCTACGGGGATCGTTATGTGAATTTCAATTTGCTAGTGTGGGCTT
TCTTACATTTATTGGCGTTACGTATGGCCGGTGCTGTGCTGGTGACGCAT
TCCGAGCAACGTGACAGCAGACCCATCAAAGGGAGGTGGGTCTAAGCCAA
CTTTTTGTGACGCACATTCGGGATCTGGGATCTGTGCTTGGCCGGGGTCA
GGAGCTGGTTAATGCTCCACCTGCCCGGATCCGGTGACGGGTTTATTTCC
ATTGCTCCGCCTTCGTCCTTTATTGCGGACCTGATGCACTTGCAGCGCTG
CGGGAGTTACGTAAAAAAATAATAAATAAAATGGCAGAAGCATGCGGAAT
GCTGCCATTCCGGCTAAGAAAGTTTGCGTCGGTTTAAACTACATGTGGTT
TCTTTAGTGTTGCTTTTGTGGTCTTTTAAATGTCGCATTCGGGCGAAAAG
TCACAAAAGTGGAATCAAATCTGCGGATTCACTTAGCAATCAACCCCACT
GTTTGCTTTTATGCTCCTTTGAGAGGAAACAATTAAGGGCAAAAGGGTTT
CTCGTAGTCAAAGCCAATCTGGATAATTTGAGAGCACCTTCAAGTAGTTA
CACAAACTAATTTTCTCCGCCACAACTTTGGCGTAGCATTAAAGACCAGT
TAGTGATTGCTGCATTGATATGCAGTGCACATAGCTACTTTTCAGCACCT
AAACACGATGTAGATAGGCCATTCATCATTCGAAATAAATCCCAACTAAT
CGCCACACATCACGTTGCCGCTATAAGAATACCACTGCCAATGCCAATAC
CAATACCAATCTGGCCAGAACTTTTGGCCAACGATTCTTTGCATGAAATT
TGCAAATCGTTTGGCCATTCAAAAGTTGGTACTCCTCACCCCACCCCACG
CACCGTTTTGTGCACCACTTTTTAAGCGACTGACAATAACAAGAAGGGCG
AAAATCGAAAAGTTGCGAGCGCGCGGAGGGAAAGCGTGAAAATCGTGGTG
CGAGTGTGACAATTTTCTCGTATGTGTGGAAAATGAAAGAGAAAATTAAA
TTTGCAGGTCACGTAATTTGCTGGTGTGTGTGTCAAGTTTGTTCTGCGTG
CCAGTGTGTGCGTTAGTTAATAAATATGCGCGCACGCGATGTAAAAATAT
GTAAATCCAGAGGCAACACACATATGGCCACCGAATCGATTCGATATTCG
AGTTGGTCTATACTCGTATTTGTTTTCTGTTTTCGCACTTTACAGTTATG
ACCCAGTATATTCATTCGTGTTTTGGATCTGCGCGGAATTCCCCAGGGAA
TACGGCCATCCAACAGGGTGAACAAGCAATCCCAAAGATAAACTTCAAAG
CGTGCTCGATGAGTTGAGGAAGGGAATTCAAGTTCATAGCCTATCATCAT
TTGTATAATAAAGCATCTACCAGCTTTCGAACTCTTTGACTTTTGTAAAT
AACACACTTAACCACAAATAGATTTAGGCCTACCATTTAAGCCAAGCGCA
ATTCGTTTACCGAAACACATAACAAACTTCGCTGATTGTTGGAAAAAAAT
ATGCATAAATGTGTGGCAATGGCTTTAAGCACTGAGTGGCCCGAGAAGGC
AGCTTTATGATTTCGGCCAGGAGATATGGAAATGGCTTACATCCCTGCCA
AGCTTTCTTCCTTCGAGCACTTCTCCATCAGCGTTTCCTTGCACTTTTTC
TGTGGCATACTTTTTTGGTTATTAATGTTAAAGTTTTTGTTGCTGTTTAT
GTTCGGTTGTTGTTGCCGCCCTATCTGGCGTTGCTTTTATCATTAACTTT
ATGCAAAAAGTTTTCGTCCTGGTCCTTTTTCTACCCATCGGAACGATGGG
TATTTTTTCTTTCGTTTTTTTTTTTTTTGTTGATGCTGGCAGGCAGCATC
ATTTGCAAAACGACAAATAGTTTGGCTCACCGAACTGGCCATATGGCAGA
CAGGGCCATTGTTGAGATACCACCCGTTCCTTTGGCACACTTCCCTAATG
TATCTATCCATCTCTCCTTGCAGTACAATTACCTCATGCAGTTTGATTAT
CTGCCCAAGTCGGACCTGGAAACGGGTGCTCTGCGCACCGAGGACCAGCT
GAAAGAAGCAATCCGGAGTCTCCAGGTAAGAGACACATTCCCTCCCAGCG
GCTGCAGCCGTGCCATGACATCCCATCCCATCCCACTCATCTATTATGCA
CAATTTCACAACTAACATTACCGTCTGCAGTCTTTTGGCAACATTACAGT
TACGGGCGAAATCGACTCGGCAACGGCCCGGCTAATACAGAAACCTCGGT
GCGGCGTGGGCGACAGAAGGTCCGCGGACAGCTTCTCGCCAGATAACCTG
TATCACGAAATCGGCTCCAATGTGCGGGTGCGGCGCTTCGCCCTGCAGGG
ACCCAAGTGGTCCAGAACGGATCTTACGTGGAGGTAAGTCACCTTTTTGC
AGCTCAATGGGATGGCAAACGGATTGGTAGCACACATTGAATGGGAGTCA
GTGCGGCATAATGCATGGTCTTTCAAAATGCTATAAATTAAATACATGAA
AAGTGCTTTAACTGTGCTCTCAGTTGCTATTACTTATAACTTTTGACTAG
TCCACTCCTTATTGCGTAACTATAGTACATCACAAAGGTGTTGTGTCCCA
AGTTTAAACTGAACATTATGTTAACCTCAAGTTATTCGGATCATGTGATG
AATTTTCTCGAATGAACTGGGTTTCTTAACCTTGCTCCTTGGCAACCCAT
CATTATGCACCTCCGTTGGCAACCCCCCATCGACTGGCTTTACTTTCCCT
CCTGCGGATGTTCATTTCAATTAAACTGCATGCAGTTCATTAATTTTGCA
GCGTTCATTTAGATGCGAATTTATAATTTACAAGGGGCTGTAAGGCGAAG
TCGGTGGAGTGCTCCTGCTGCCGAGAATCCTGTTTTTGCTCGGTTGTCCT
GTGCATACGGGCTGTCAATTAATTCAAAACTCAAACGTTGCGTAGCTTGT
TAATTTTTATTACGGCCATTGCACTGGCCCCCAGAATGGGATTGCATAAT
TTGGTGCCCGAGAGCTTGTTTTTATTTTTATGTAAAACAATTCACTGCTT
TCCGGAACCTTAGTTGGCTGCTGTATCCCAGTTGCTGCCGGTTGTTCCCG
GCTGTTGGCCAAGATGACCCGCTGGGCAGGAGGAGCTGGAAAGGGTGGGT
GGGTGGTTGCCTTTCATTAAACACTTTGCGCCAAATTGAATTTTACGATG
AGCCGAAACGAAGAGAAGGCCCTCTGATTGCAGCTGTCACTTTTAGTGTT
GTGTTTGATTTTTAATGCGCAGCTGCATAATTGCGCTTGAAATATTAAGC
AGGACAGTGCGCCGGAGGAGTCTATCTCATTAGGAAATTTTCCAATTAAA
TTTGCATAGCTTCGAGGAGCTGGCTGGTCTTTCGCCAGCGAGCGTTGCAT
ACTTTCGGGCTGAGCTGGCAAAGTGCAAAAGCTCATCGCCACATTGCACA
TACGCCGTGGTGGCCCTTAAAGCTGCTGCTTTCGCTCCGTTCAGTTCAGT
TCGGCTCGGTTCGGTTCGGTTCAGTGGGGTTCATGCAGCGATAGCTATTT
AATTATTTCTTGTGTCGTCTACCCTTAATTGGCCATTAAGTGGCAAGCGA
CCAAAAGGGGCAGAAACGGCAGGACAATATTGCGACTAAATTAAAGCATT
ACGCAGCATCCAGAATCCCCGGATCCATGGATTCCCGGCATCATGGCATC
CCGGATCACAGCGGTGGCTGTTCGCATCAAATTGAGTTTACATGAAATAT
ACATATACCGATAGCGATGAGGTTGGCGATGGCATATCAATATGTATTGA
CCTGCTTTTCGCCTAGCTGCATGTGTTCTCCTTAATTGCAGCACAAAGCG
AAAGCGAGTAGACGAAATGAAAGCAGGGTGGCAGTGGCTTCAGTTTGGCT
GATTGTGTGATTGTGTGCTGGCAAGTGTTTTTCCATTTCCGCTCAGCATG
GAAATTGTGGGACGGAAGTCGTTCTTAGCAGTTTTGTACTCATTTTGTTT
TCACCGCGTTCTCGCGAAAACACACAATGACAACATCCTGCCACAAAGTT
GTCGCCAACTCAGAATTCTTTGGGATATTAACTGTCGGAATTGCTGTGGG
CTGCACCGAAAGAAATTTAAGGATTTGTTAACATCTGTTGAGATAATTTG
ATTTGAGAATAAAGAAACGATTTAACAAGCAAGTATAAACTTTGCTGCTA
CGTTTTTAGTATATTGTACTAAATGTACTTTATTTATTTAAATCCATAGT
TATCTCTTTACATATTTCGATTGCAGTGCAGCCACAAATCAAGTGACAGC
AGCAGCTTCAGCGGAAGTGACCAAAAACTTGCACTTTGCGCAAATGTTTA
AACTAAATTGGCAATTGTCCTGCAAGAGAATAGAGGGAGAATCCTTGTTT
GGCAATAGCAATAGTCGTAATATGGCATTTACTTGGCTGCAAATGAAGCT
TTCTCACTTCGCCCATTGTGGAGTGTTTACTCACTTTTCCTTCAACTTAA
ATCTGCCTTAATTAAGTCAGTTATGCAGTCGGGCTTGTGTTCCAGAGTCA
ACTTGTCAAATGGCTATTGAGGGGAGCAAAAATGCTTTTCCTTCATTCAC
TCCGTTTAAGCTTCAATTTTTCATTTTTCATTTTCCATTTCTCTCTTAAT
GCATCGGCAAACAATTGTCCAGCCAGGAAAAGTGTCAATAAAAGGAAAAC
TGGTCTTCACACCTGTTGCTCTTTTCCATTTACCTTTTGTTCTAGCTCAA
CAGTTCGTAATTCTTGCGTTTTTTTTTTGAGGACTAGAAAAATTGTGGAA
AAAATTCTTTAAATATTGCAAAGCGAAAGTTTGCACGAACTGTAGAGAGT
TTTTTCTAATTGACCAGTTCATTTTGACCAGTTTTCGCTTGTTCCCTAGC
CTTCTCTCTATTAGCAGCTACAATGTGGTCAAGAGCTGAACGTTAATTGC
CGCTTTTTGTGGCATTAATAAACAGCAGTGAATGTGCATTGCGCACTTAC
TGGGTATTTGTTAGATTTTTAACAACATTAATAAAGTGCACGGCGAAGTC
ACAGGACCAATGTTCCGAGAGTCCTTAACACGCACATTCTTGCGTTTGCG
TTTATGCTTATTAGCGTGCATGCGAGCCATTAATACGGTGCACTGAGAGA
AAAAAGCAGGGGTGGTTGGCACGTGGGACAACCTTTTAGCTGCCGTCGCA
TAAAGCGGAGACGTGAACGGATGTCTTCGGGCAAATGTCATAAAAACTAT
GCGCCACTCGGCAAAATATCGAGCAGACAAGGACTTTCCCAAATGCGCCA
TCCTGCTGCCCATGTTACAATGATAAAAAGTAATTTTATGACGGCCACTC
GCACGCCCACAAAAGAAAAGGACCGGATCCTTGGAACAGAATGCAGCTCC
ACCTCGAGCTGCATCACTTGGTGTGGGACATTATGTCCTTGGCCAGTTTG
GTGTCCCTGCTCCTTATGCCGAAGCTTTTAACCGAAGGATGTAACCGGAA
ACTCCCAGCCAAACTCCAAATCTTCTTTGGATCAGAGTTTAAAGAGTTAT
TGTGTACTACAAGTTTAACCAAAATTCGAGTTTCATTAATTCTTTATTAA
TACAGTTATATGCGAAAAAAAAAACAGATATAAAAGTCATTTGCAACAGC
TGCAGCACGTACAAATCAGTCAAAAAAGGGAGAGTGAAATAATCTGGAAA
AAGTTTGGCAAAAACAGTTTTGGATGACTGCACATTGGCAACTAAATCGT
GATCCGCAGAATTTCAAATGAAAGATACTTGCTGCCCCAACTTGTGCACC
ATTTATCCCTCTTATATCGCCTTTATTTATAACCCATTTTTTACGATTTT
TAATTTGCATAAAATAATTTGCTGATCAACACCAGCGAGCGTTTTTCTCA
TCATAATTTATTCGCCAGGCAGAGTAAATCACACGCACTAGGCCGAAAGA
GAAGGCAGCTACGGCGTGCGAAAGAGAGGGCTGTAAGGCGGGAGCGAGAG
GGAAAGGGCATTTAATGCCGCAAACAGAACATGGCAATAGTTTTATGCTG
CTTCAGCTTCAGCTTCTGTTGCTGTTTATTTCGCAGCAGTCATTTGCAGA
GTTGCCTTTACTGCACTTTGTCCTTTATCCGTCTCATCCTTCGCGTCCTC
CGCCTGTGACCTCCGACCTCCGATCCCCCATCTACCCATCTCTACTGACA
TTCCACTGTCCGCCGTCGGTCCGCTGTGCATTTTTTCGGGGGGCGGCGAG
GGCTAATGGGCGTCCATTGGCCATAGTTTTCTGACTTTTCGTATGCTGTC
AAGTGCTCGGCACTCGAAATTATTATCTGCCATTAATCATGGCCATAATG
TTTGCCAGCTATAAAACGGAGCAAGTGCAGCCAGAACAGGACTGCAACAG
CGAACCGGACTGTACACAGTAACTGCTGGCAGTAGGCAACTGGCAGAGGG
CAGCTTTAAGGAACTTCCCGATGGAATATTAAAAGTAGGAACTAAGCTAG
TCGGGTAAAATGGAATTGCACAATGAAAAGGATCTTTTAGCAAGTGGCTT
TCAGGGCGGGTGATGGTAAATTAGATGCCACGGCTGGAAATCGAAAGCGG
CTTATGCACATTCTTCAAGAGTTCACATCCACTTGAAACATTATGTGTAT
GTCAAAGGGATAACTTTACGATCTGCCCTGCGGCGGGTCAGTTATAATTT
CGGGCATTGCTTTATTACTGTGACAATTATTTTAACTGCTGGAGATTTTT
ATTATGATATTTTTTTCATAAAATTCCGTATCTGTGCATTTTTTTGAAGT
CATTTGCCACTTGTCTGGGTGTCTTTATGGGGCAAAAGAGCGAATAAAAC
CGAAAACACAGGGCGCCGAAGAAACAAAAGTGCGCGTACAGTAGGGAACA
AAAGCTCCTTGAGGTAGAGCTAGCAAGTATTGTAAACTAAGCTCGTGCAT
AAATAAAATCCTCAATTTGGGTTCATATTAAAATAGACATTTTGTGCTGA
GCTCAGACGGAGCTCAAGGAAACTGTGTCAACATCTGTCTGTGTGCGGGC
AGTGTCTGTGAAAGGATTGCACTCGCACACACCACACACACACCACACAC
ACACCACACACACACGCCACATACACTCCCACATACCTCGTGATATATGC
CAAATTTATGATGTGGCATATTTTCTTATGCTGGCTTGGGCCTTTGAATT
TTGCATGAACTTTGATAGCATATAGCTTAGGGTTTCCTTCCGTTCAGCAC
ACAGACACACACACACACAGATATGTTTATACGTGCAGTATATCCTTTGT
CTTAGCGATTACTCCTTGAGTCGGCAATCCGATACCGCAAAAGGTGTAGC
ATTTCAAAATTTAATAACCAAGTGGGCTGCAGAATTGCCACCGAACAAAT
GCCTATAAGTCCCTCGCTTCCTGTTCGAGCTGCGGGCGAACCGAATTCGA
GCCATCGAATCCTCGACTGTTAGGATTGGGCTTCCGAGGGACGGAACCCA
TTGAAAACCCATTTGCCAACCGCCCGCTGACACAGCCGCAACAACAGCAG
CTGGCTGGTGGTGGGTAAGGGGGGAATTGGTGGGGGGAGAGGGAGGAGCG
GATGGACGAGCGGTCCGCTTCTTTGTACGTGTCAATTCGGGGGCCAAAGA
CTGGTTTTTGCACATACAAAAAATATGTTAGCATGTCCAAATGTTTCGCT
GCCCTCTTCAGCTAAAATTGGTAACTTGGAGAAAAAAGAAATCAAACATC
CAATTATTCTTATGAACGAAGAGGTCAAATTACGATTCATTAAATATATA
TAATATTTACATTGTTTTTGAACTTTATGTTTTTCATTTCTGCACGCAAA
GATATGTGTCATTGCAGCTGTAAGAAGCGTGCGATTCATTTTTCTTAGTG
TAATGGGCTGGGTCTGTGTTTTTCCGTTGGCTACTAGTCAGTCAGGCTGG
GCATTCGGTTTTTGTGCCACATCAGTCACTGCGCCGCAGAAACATCAGGA
GCAGCACAAACACACCCGCCGTTGCAGATCGTCCTTTTTGGGCAACTTAA
CACTCGCAGGATGTCGCTTAGCCATCCTGCCACCCAAAAGCACCCAGAAG
CCGTTGCTGCATCAGTTTTGTGTGCTAATTTAACGTCTAATTTTCCATGG
ACAGCAAATGAGCAGCTTCAGCTGACGATTTTCGGCTGCCTTTGTTCCTC
TGTTGCGTCAAAACCATCAAAACGAGATGACGCAGCAATTGAAGCCACGA
AAGCGATTGCATTTTGTCACTTTTGTGATTTGACACCGAAAGTTGCCCAA
CAAAACTTCATTAGTAGCAGTCAGTATATTGAGCGAAACTATCGCGCACA
TATTTACATTGCAATGCGGATTTACAGTAGGTATTTATTATTATGCTATT
TATGCATATAAAAAAAAAAAAAAAACCGAAATTAAAAAAATGTTTCCACT
ATAGCAGAGCAAGGTTTCGATCCTCGGACCTCTGAGTTATGGGCCCAGCA
CGCTTCCACTGCGCCACTCTGCTCATATGATATTAGCGAGATACATTTCC
AAATAACAGGGCGGCACTATGAAAATTAGCATATCGATACACAGATGATG
AAGCCAACAAATTATCAAAACTAAAGGTTAGCGTGAATGTATGATAAGCA
GTGATATCAGAACTGGATCCTATACGACTAGATTAGATTAAAGAACAGGT
TGTTGTTTAATGCACTCTGTATCTATGATTGGTATTTAGTAAAAACTTGA
ATCTAAATCAAAACAATAGCACTCCAAGAAATGTCCTTAAATATTCAGTA
CAAATTAATAGCTACCTGAAAATTGAGCTCCCCGAGGTGTTCCATTTAAA
ATGCATCCGAAAATTGAGATAAATTAGCAATGACGCACTATATTGCCAAG
AATTCACCTTGGACCATGACGCAAATGCTGACGAGGAACCCAAGCTCACT
ATTTATATAGATGTTTGTGCCCATACATATGATCCTGCTGTATTATTATA
CACGTCTGTATAGCATTGGCATCCGCGTAATTATGTTTGCCTCCGTGGCC
AGGAGCAGCGGGAATCACAAGGATGCGGATGGTCAGGATACGGGGCTCGG
ACAGCACAGGAGCGGGTACTGTGGCGGAGCCAACAATGTGTGGCTTGAAA
TTTGACACTTTCACAGTTGGTCAGTTGATTTACTCGCCCCCGGAACCAAG
GCTCCACCCCTCCACCGCTCCTGCAGGCTGTCTGCATTTTGTTAGATTAA
TGTCCTGTTCAATCATCAATGGTTCAGCGTACAGCGCCGTCTTTGTTTGT
ATAGCACTTGTTTATCGCTGTCCTGGATGAGCGGAGACACTCGCAGGGCA
GGAATAAGGGTACACTAAGAAAAGTTCTGAACTATTTCCTGCTTTAAAAA
GAACTGGAGTATAGGAACGTTAAAAACTGCATGTTAATTAGAAGTTGATA
ACTTTACACGCATTAAAAAGGTCTTAATATTTAAATTTGAATTCAATTTT
CGCTAATATTATTTCACATAATTACAAATAAAAAATGCACGATGGATAAA
ACTTTTCTCAGTGCAGGACTGGACAACGATAACGGTCATCGTTGGTGTGA
CTGTGTGCGTAAGCGACCGCTGTTTGTGTTGGGTTTCATCCTTCGGTTGT
TGCCGCCGCTTTTCGGTTTCCTTTTCAGTCGCTTCTTTCCTTTCGTTTCC
CGTTCATTTGCGCCATCCCGCTTATCCCTGTTCCTTTTGGTTCTTCTGTT
TACTGTTGTGCCCCGTGCATTCATCCTTTGCTTTGTTCTTTCGTTTACTT
TTAATTCATTTAGGTTTCGCCTTGATTGATGACCACTTTAATTGCGGATA
TTAAATGACAAGCGCCAGAATCAAATCGAACTGAAAATGCAAAAAAAATG
AGCTCTCTAATTTTCTGGCATTTTTCCCTACTAGAGCCGCTCTCCCTTTG
ATTGTGGCATGATTTGCAGTAAACATGGGATTTGAGGCTTTCCGCATCGA
GTTAATCAGAAAAGGGAAATATGTACAATAGACAGGGTTTTTCTAGGATG
AAATAAGAAGATTTTCATAAATATCTACTGGTGCAGTCTTAATACAGCAA
CATACATACTCCGGGACTATAGACCGATAGAATCCTACAGAAACATATAG
GAATCTTTGTGGTAATCATCGCTATCCAATGTTACTTATGAAGTGGAAAA
TGTACTCAAGAAAGCAGGGACTCTCCTTAGTCCTGTTTTTCCTATAATTT
TCCGTCCTCTGCTCTGCGACATACCCGTGTAGCCTGCACCACGTATAAAC
CCAAGGAACTTTTGATTAAAGGTCTCTTCTTGTCCTCGCAATTTTACGCC
TTTGATGTGGCCGCGATATAATGCTGTTGATACAGTCCTCCGGAGGAAGG
GACGAAACGGGGGACACTGCAATCGCAAGTGGGTTATACTCGCTGTAACT
ACATAATAATTCTAATGAAAAATGTCAGGAGGCAAATTTGATTACTGGCT
TTGATTGTCAATTAAAGCCCAACAACAATTTGCCGTGCGGTGGAATCTCG
TTACGTTTATATGGTCGCCAAGTCGCCAGGCAGACAATCTATATACTTTG
TGCCCACACATATATTTATGGCGCTATGTGCCAGAGTTGATGACGAGCGA
ATCCTAATTAATTTTGCAGTACATACAAACATATGTATGTATGTACGTGT
GTTTGGGGGAGTCTTGCATTAAGTGACACAGCAACGAGTCACAGTTCGCC
CTCTCATTAGCCGCATTAATTGATAAATTGATATTGGCTTTGGGGTAAAA
GTGGATGGGGGGCATTGCTCGGAATCGGGACAAATGAATTCCTGGACACC
GGGTTACGCTGCACTGGCCTTCTGGCCGCAAAGTTTCCACTCCAAGCCAA
ACTGAAGTTTTGGGCGAATCGGAAAGAACAACATCAATTCCGGGCATCCT
TTTCGGTTCGTCTGTTTGTCTGGCTGTCAAATCAAACTTTGATTTGATTC
GTTCGATACACCAACTGGCCGGTGTCCAAACTTTTATTCAAACTGACAAG
TTTCGTGGCCAGACCAACAACAATCAGTTAATGCAGGCGGTGCGGCATGG
TTTACTACTTTTCTCTTTTGGTTTTTTTTTTTTTGATGTTTTCTGAGCCC
TAGTTGATTAATAGATGGACGCTTTAGTGTCACAACCGTCTTGATTAATG
TTTGGTCCAGCGGAATTTGTTTGTTTGTTAGGCCCGGAAAAGAATGTGAG
GGAGGCCAATTGTTAATTGTGGTTAAGCGCTTTTAATTTTCACATGTGAG
TCGAGGTGAGCCAAATACGAACCATCCGGACCGAGCCGAGCCAAAACGAG
CCCGACTACGCCAGCCGAACTCATTAAAAAGCCGAGCGGCATTTAAGGAT
GCGCCTGCGCAGCAATCTCTTATACTCGCGCGAAAGCTCTGCGAAAAAGC
TCCGAGATCGAGCCGAGCTTGGTGACACTTTTCGTTGAAATACGGCGGCA
CACTTGGCACGGAGCTCAGTTACTGCCAAGTGGTCAGTGTGAGTGGTGCT
CCCAGGGAAGGACAAGCCTTCTGGAGAATGGAATGGAAAGCCTCAGCCGG
AAATGGAGCCCTCCAGTCAGACCACCAAGATCATCTCGGCATGGAAATGG
AAATGGATGTAGAGGTGAAGGTGGTAGTGGAATTGGTGATGGAGATGGAG
ATGGCAGAGGAAGTGAGCCACTCTAGACACGAATCGTGAATCAGCGGCGC
ATTCAACGTCAACACGTAATCCCCGCAAGGACTGACTCGTTCTCGTCGTC
CTCCTCATCTTCGCCGAGGTGGAGGCATCATAATAATGCCCCCGATTAAA
GAACAAAAAGCCAGGCTGAAGTGCTGCAAGTCATTTGTGTGCTCATTGTG
CAAACAGATCCCGGGTCCTTGTTCCTGGTTCCTGCGCCGGAAACGCTTTA
AGAGCCCCGCCAGCCGAGGGCTTAGTGCGGGCACATAATGTCTGCTAATA
TTTGAAGAGTGCGTCGCATTAATTGACATGAAAGAGTCACGAAAAAAAAA
AATGGGAAATGCTAAAAGAAAAGAACAGGACCACCGAGTGCAGCCAGCAG
AAAAGGATGTGCGCCTCCTAATGAGTGCACGACAAAGCGGAGCCTTCTTG
ATGGGTAAGTGCCTTTGGCTAAGACGACTTTAGCCCCCAACCAACCAACT
AACCAAGCAGCCAACCAAGCAAAACTCCTTCGAGTGCTGTGATTTTGCCC
TATGCCAGTGATTTATGCGCCAATAAATGCAGGCGGCCACAAGGCATTAA
TATTAGATTGCAACCTCGACCATCGGGCGGGCCATATATTCTGGTCGAAA
TTAGCCTCGATACCCTCTGGATCTCCTATTCGCAGTGATTCCCGGTCTCC
CTGTTAATTGAGTGCCGTGAGAATCTCTTCATAAATTACACAATTTTCAC
CCGCTTTTCCGGCTACGGCCATTAGCCCCGTTGGCATATGCCAGCAATCA
ATTTGAAATTATACGCCACAATTTCTCATCGCCACCACCGATTTCGATTC
TGCCGCTGTCAGCCTGCCAATTAGGGGATATATATGCCTATATATATGGC
ACTAAAATGCAAATGGGTTTGCTGATTTTTGTTTTGTCCCCACTTTGTCT
GTCTGCAATCAACCATCAATTGTCAAACATTTTCTAGTTGATTACTGTCT
CTTTTTTTTTTTTGAATTCCCAATTCTAACGATTGTCATTTTTTGTTTGC
CGTTCTGTTTGGGGTTTTAAATTTGGCTCGATTGATTTTTTCACTGATAC
ATTGGCTTGTTTGGTGAAATTAATACTATTTATTTGGCTTTTTTATAAAG
TAATTATTCCATATCGATGATTTGCATTCATAATACGCTCTTGATACTTA
ATACAAATATATGCTTGTTGTTGTGTCAAAGCGATTGGCAAAAGGTAAGA
GAATTTAATTAAAATGACTCTATTAATGAGGAATTTTTAAGTACCGCTTT
TTATCTATTCCAAATATCTAATTAATGGAAAATTAAAAAAAAAAGTTTCG
GGCATTGTTCATTTTATTTTTGATTTTATCTTTGCAATTAATAAAAAGTT
GCGATATATATGCAATAATTTGAAATATTTAAAATTGACGCAAGTTTCTA
GCTTATCATTCAAATGAGAGCTATTAATGCCAATGCATTATAATAAAAAG
GCTGATAATATATGTAAATCACTCACGAAATATACAGAATCCTAGGAATA
TGCCAAATTAGCTAGCAAACTTTGCTTTCAAGTCCCCCGCTCTTTTTAAA
CCTCTGGCTTTGTTTATGGCAACTCGCCACAAACAAAACCAAAAGATTTT
AAGCCAAAAAGTCAACCCTCCCCTGCCTTTTGGCCATTCGCCCCGAGACT
TGAAATCTTTTGTAGATTTGCTTGAAAGACAAAGACTGCCTAAAAATTCA
ATTAAACAGAAAGGAAGTGAAAATCGTTTGTCGCTGGCGCAAAATGTTCC
ATATTATATTTAAATGGAATTAGTTTTAATTAAGTCCGTAGCTAGGTTAG
GCGCAGCCACAAAGAAAATTCCCATCCTGGCCAGAAAAATGTTAACAGAC
TCAAATTACCACCTCCCAGCCCCAGGAACCCTAAAAAAAAAAAACGAGGG
ACTCAACCAACTTAAGCAACAGCAACAAACTGAAACCAAAATGTAGCCGC
CAAAGGAAGTGATTAAAATTTTACCTAGCCCCAAAGCCCCAAAACTCGGG
CATCGGACCCAAAACCCAAAAATGAAGACCAAGGAATCTCGCTGCCCTTT
TGCTCCCTTTTACCTTTTCTGGCTCTACTATGTATACCTATATATATTTT
TTTGTAATAAGTATTAATTAATGCAAAATGAAGACGAAACGTAAGTAGGG
CTTCTGCTGATTTTGCTCCCGCTTCTTCTTTTACAAAAGAGCAGCCGTTT
TGCAGTTGTTCCCTCATTTTTAGTTGCTGGCTGATTTCTCGCTGTTTTTT
TCTTTTTTTTTTTTTTTTGAAATTTGAGACCCGCCGTCCAAGCAAAGTGA
CGCAAATTAAGAGAACCCCTGGTCAGGAGCAAGTCAAGCAGAAGCAACTT
AATGAAAACGAAATTGACACCTACCTACCTTCCTACCTGGGTATGAGAAT
GTCTGTGCAGCTCCTTTGGCTCCTCAACCCCGTCCTCCGATCCTGACCAC
AACTGTAAAGTTATACGCACGTCTGGCGTTACCCAGTATACTGTGGTGGA
CATGGAAGGGCGGTTCGGTTTTTCTTTTTTTTTTTTTTTTTTTTGTTCCG
GGGGAAAGGACATGTCAATAGTTGCCCGCTTCGCACTTCCTGTGACATTC
GGCTGCCCATCATCGGGCCACGCCACTCACATCCTTATGTGTCCTGTCCT
GCTCTGTGCTGTCCTGTCCTGTCCGCTCATAAATCTTCCGCTCGCATATT
TCTGGGTGTGTGTGTGTGTTTTATCTGGCTTTCACGCTTCCGGGCGCTCT
TCCATGACCCCCAATACTCGATGCTGGAGAACCCGGATCCAATACGAAAA
CCGAAAAACCGAATTGTGTCTCCAGTTATTTGAGTTTCGGTGTTTAGCTC
ATAAATCTGCTTATCTGGGGAGTTGGATCCATCCGCAACCCCTGGAATAG
GACTAAAAGTTCTTTCAGTTTCAGCTTCAGTACGAGTCAGTTTTGTTTTC
TCAGCTTTCCCGGCTTTCCCGGCAGCTGGATGGCATTAAAGGCTAAGGGC
TTTGCAACTTGACCCTGTTGCAGTCATGCATAAATTTCTTAGATTCCCAG
CCATTGACAAGCCGCACACACTCCAAGAAATATAAATTAAAATATGTTTC
AGTAGTCAGCAGCAGCAACAGCAGCCGTATTGGGCCCAAAGTTATAAATA
TTTTTGGGGGAATTAATTAAGCCCCTGCACGGGCCGAGCCAAAAAGGAAG
GATAGGCACCAGAACCAGGACCAAAATATGCACAAAATGAAATTAGAGCC
GAAAAAAGATAAAAACGTAATGAAATGAAATGCGGCCTAAATGTTTTCAG
ACATTTTGGGTTTGTCGCAGGCGGTAGGAAAACAATGAAGGTCCAATAAA
TTGGCAGGATGCGGCAGGAGGCAGTAGCCGAAGGAAATTGAAATATGTTC
GGCCTACAAATGGGTTGGAAGGATGCTGTGTGAACTGGAGTGTAAAGTAC
AGGCTCCTAATGAAGGATTATGGGGCAGGGGAAGTGCTGTAAAGATTATG
GCTTCAGGTTCGAGATGATCCATTGTTATCGACAGTGAACAAGTTGGGGA
AAACACAAATTGCCAGAATGATATATATAGCAAGGAAAAGTTAGGGGGAT
TCTGGTTTTATGAAGGGACCGCCCGATTAATGTGGCGTTAATTGTAAAAG
AAAATGGCAACGATGTAACAATTATCTAAAGACGTTTAGCGCATTAAAGG
CTTTGTGTAATTAAATTATTAACTTTGACTGTTGCCAATTAATAACTAAG
CCCCAATTAGTTGAATGACAAGGCCCAGCTTATGAAAATTCTCAACAAAC
TGTCCAAATATTTTCATTTATTTAGCAGTTAAACCTTTAATCCGGCATGC
TGTTTAATTTAAATTCTGATGTGCGGTCAAAAATTCCTGCCCGCTCATAT
GCGACAATTTTTCTCGGTTATTTCTATTTTTATGTTGCGCACGTAGTTTT
TCCTTGGCCGAGCAGCAGGATGCGGACAGGGCGCACTGCAGGACACTTTC
GGCTGCAGTCTGCATACGTCATCGAACTGTTGACCGAGTTGGCGGCTGGC
CAACATGTTGCCTGTTGCCTGTCAGCACAATTTCCAGATAGGCACGAACT
CCATACTCGGGGCTCCGGACTCTGGACTCCAGTTACAAGACCACCAAAGA
TTCAGGGCCCAATAGCTGAGCCAGGACACGCAGCTAGGACACACTGTTTT
ATGCATTGCATGCACTAAGGCGCAAAGTGTTGATAGAGCACACCCATACC
CACTCCCTTACCAGCACTTACTCCCCAGGACAGCGACTCTGACACAGACA
GATGCAGATTTCTGCTGAGACTGCAGGGGGCTCCAGTGGCAGGACTCGAA
GCATCCTGCAGCTGGCCCCGTCATAAAGAGGAAAACTGAGCTGAGCCAAC
TGCAGTGGCAACTATAGTACAGTGGGTGCGCTCCGAACGGCAGCCATAAA
ATTTCAAAACTCATGTCCAAAAAACGTGGTGAAATACATTTCCTTTAGTA
AAAGGACGCTGAGTTCGTATTTTATGTACGTACTGACTATTTTCAACATT
TAATTTGTTGCATTCAATAGCTTATAACTCAAGGCAAAAATTTTGTTCAT
AACTTATAAAGCAAGTTATTTACAAGCGAGTTAAGATGGTACAAGCTTTA
TTTAATGCGTCACTTTAGATCTGTGTGCGGTATGCTCCTGATTTTGCAAC
ACATTTTCCTGAATGTAAAAGTCTCTGGGCAACCGCAGAAAAATGAGTGG
CGGCCAGTTGGCAATTTTTACCTGACCACCCAGCTGGATGCCGCGGAATC
CGGGGCTGCCATTCTGCCACTGATGATGCTGCTCGCCTGGCATCCATCAA
ACACCGCCATATTGAATCAACGCAAAATAATTGCTTTTTAAATGGGTTTT
TATGCCGGCACCGGGTGAGAGAACAGTGCCTGGATCCTGGACATGGCGGA
GGGCCATAAATTCAAGGAATCGCCACCTTATAGCCGCACAACTGCCCCTG
GGGTGAAGTTTTTCTCGACACGAATCGAGATTCGCTTTTCTCCTTGAATT
CCCGCCGATTTGTGAGCTTTAATTTTCAGATTTATGCCCATGGCTGCAAG
GACGTTTTTAATGAGATTTCGCTTGGATAGTCCGAGAAGGATAATGGGTG
CCACGAAGGGCAATGGCGGCAGCACGGGGGGCAGTGGAAGTGGAGGAAGT
GGAGTCCGAGGCGTTGACAGACACAGATTATGAGAGATATGCCAAAAAGT
TAGTGCGGTTAAGCAGCTGCTTCTAGTGGAATGAAATCGTACTGGATGAT
GAGTTCGGGCCAGGATGGGGGCTTATGGACGCCAACTTAGGTTTCTCATC
GGATGATGAAAGTATACATAATTTGCAGCGTCTTCGTTTCCCGCTGGGCC
ACAAAAGTTTCCCTTGTTTTCAGTAAATTTGCGTTCGGCGAAGTGGTGAG
CATTTTCCACCCATCGCAATAGTCATCTTTTTCTCGCCGGGGCAATGACA
ACATAATTAGCTCATTTATCAACTGAATTTGTTTTGGTTAAGTTGGATAA
ATCAAACGGAAAGAATTTATGTTCCTGCTCATTTTTTAACTATTTTGATT
TAGTGATTTCTGCGCTGTTGTTTGTTGATCAGGAAAAAGTAACATAAATT
TGGAAAAGACCTTATCATAGATTCATTGGAATCTTGCAATCTGATCTAAA
TACTCTGCTTGGCATGCACTGGGAAAAAAAACATGCGGAATATGCGATTT
CCCTATTGTTTTGCATTGTTTCGTTCAAGCTTAAATTAAAAATGCCATGT
TGTAATAGGTCGATATAAAAATAGAAGCAAGACCGAAAACAAATTGAATA
TTTTCTCGCTGACAACAATCAAATACAATTTGCATCACGACCACGAGAAA
ATCTAGAGCGACAGGGAGAGGTAGACTGTTAGAGCAGAGGGAGCGATGCG
AGTCATCGAGGTTGTTTATGCGCGGACTTAATTGAGATCAACTGAAAGTG
TCACGTCATGTGGCCGAACTTCAATGCGAGGCTCATACGCAAATCGAGGG
AAAGACCGTAGAACTTGTATCTTGCAGTACACCAATACACCCCATTCACA
TACATAAGTAGTTCACTGGCAGCCAAAGAGCTCATATCACTACCCGATAA
TTGCACACATCTGCAGAATAAAAGATAATGCCTGGCTATTAAGGAAAGGG
CGGAGTTGGCAAAAACGCAACGTTTTAGCACTTCCGCTTTGGCGCCGGAA
ACGGAAGTGTAACTGCCGCAGAGGCGCATGCACTGGCTCTTTGTCCCGCC
CACCGGCCACACCCCTTCTTTTGGGCCAAGCCGTAGTCGGTTGCATTTAT
AATTAACATAATGATGGCATTTTGCTAAACACCGTTTTCCGCATGTAACA
CACACGGCCAAAGAGATAGGTTGAGTGGCAAGGATATGACGCAGGAGTCG
GGGATTTGGGGATTCCGGGTGGCACTCAACAACGGCTGCATAGTTGACAT
GAAATGCCAACTTAATGTCAGAAAGTTAACATGCCACTTGAAATTAACAA
GCCGCGCAGAGTCCTTCTCCATCTCCTTCCCATATCCCTTTCCCACCTCG
GAAAACCCACCTCATCAACGGAATCCTTTCTGCATTGTTTTGCGCATGCA
TATACATATTTTACATATATATACACACACTCGTCCTTATATGTGTCGTC
CTGCTGAAGTGGCTGGCCCGACTTGACACAGGCGACTGGCGTGTCAGGTG
AGGCGCATTAAAAATGTAGAATTTCATCTTTTAGTCAGCAATTGTAGCGT
TTTTGTCGAGTGTTTTCGGCCCTGTCTAAGTTCCAGGACCTCGAGTGCCT
GGCTTTTGTTTCGAGAAACTGTCGCGCTATTTAAAGCAAAACCATATGCG
AACTCAATAGTTAATTTTTTCCCAAACACACTTAATTTTACATAACTAAT
GAAGAGCCAACTCCACCAGGCTCCAATGTTATGCAACAAAGTAGATTTTG
CACAATGAACTTGGCCAGCTGCCCAGGAGATTTGCATTATAGCTTCATTG
GCAGCCCGAAATTGATTGGATGCGAAAAATGGCAACCACTTTACCAACCA
ACAATGCAGTTAGTTTATTCAACTTGGATGGTTTTGCAATTGCGCTTATG
ATTTTCGCGGTATCTGTGATCGATCATTATGGGTTTTTGTTTCTGCTTTT
GAATAATGAACAAAATTCCTGGCGTTGCGGCAAGAATATCAAGTGTATAC
AAATTAAAATGACCAGCACGCGGAATTCCTTCATCAAGTACACGGGATTT
TTATTCAGAACGAGAAACCTGAACTCACTTTAAAATACATTTAATTTAAT
ATTCACAATACAGTGATACGCCAGCGTAAAAAACAACAATGGCTCGGGGC
AAGATATTTTAGGGCCCAAATTGGTCGTTAGCACATTGGCATTGAGGGTG
GTGGGAGGTCCCTGGGTGTGGGTGGTGCCGGGTGCGTGGGTGGAAAAGGT
CGCTGCAAATTACACGTGACATGCTAAATGGTTGGGGTTCGTTTGGGGAA
GGAAGATGTTCCTGGGTTGACAGAGTCACACGTCCTGCCCCGGTTGCCAT
GCCAAAATGATCATAAAATTAGCGCACAAAAGTAAAACATATGAGACGCG
ATTTGAATTTGACGCCATTACCTTCATTTGGCCACAGTTACATGCAGTGA
GAGAAAATCAATGTTTTCGATACTTTCTATTCATTGTGGCTTACTCGAAA
GAACAAAGTTAGATTATAATAGAAATTCATAAATTCTTAATTATACTACA
TCTATTCGATGTAAAGAAAACATGATTTAACAAACAGGCTTTACGGAATG
TGCTGTTTTCAAGTCCAAAGAGCACCGGGTGGTGCAGTGACTGTAATTAA
GTTAAGCTACTTTTTGTGCAGTGCACCATCAGTGGCTGAAGGATACAGTG
CTCGGAGCAGAGTGGGCGGAGGCGGCAGACACGCATAATGACGCACCAGG
CGCCAAAGTCATTTGCATATGCCAACCTAACCAAAAAACGGCAAACAAGC
GAGCGAGCACATCGCGCTCCTCGCTGAGAGCCCAAGGATGTGGGGGTGGT
GTGTGTATGGGCTGTATTTTTATTGGCAGCTGCCTTAGGCCGGAGACTGC
GTCTGCCTGTCTGGCATACTAAGTGGGCTTTTGCCACCGCGCGCGGTTGG
GGAAATGGGAAAGTGAGGAAGTGAAACAGTGGGGGAAGTGGCTCAAAAAA
CCAAAGCCCGCCCCCATCGCCCCCATTGATAATAATCGTACATTATAATG
TGTTTGCTCGCTGATAGCGTTAATTATGCAGGGTCCGCAGCGCTAATTAT
GATTTGTAAGCCTCGAAAGTGTTTCGCACTGCCTACTTGCAGGCAGCGCG
TTTTTAATGAACCTGTCGTACGTGTTCGCCGGCCAATCAATGGGCCATTG
TTGGGATTCGAATTTCGAACCGAACTGAAAATGTGCGCAATCTGCAATCG
CCGGAGAAAGGATGGTTAAAATGCCACTTGAGGCGGACAAAAGGATGCTG
CTGCAGCAGCAGCAGAAGCAGCAACTGCAGGAGCGAGAACCGAACGTATC
TGGCGGATACAGCAGTGCCGCAATTATGTTACAAAACGTTGCAATTAAGC
AAACTGGTAACAAAGGCATGACCGGGCGTTGTAACTAAATACGAAATGGG
GGACAACCAGGAGCTGAGTTGGAAAAAATCGGAGAAACAAAAAACTTCCG
CTGTCAACGGCGTTTCAGTCCCCGTATCTCCTGTATCTGCTGTACTTTCA
ACTCAAGTGCACTCTTAGCTCGACAACTTGAGGCGGAATTCGTCCTGTAT
TGTGTGTGTGAAAACGTGTTCAATTGATATTTCTGAACGCGCAAGGGAAA
AGTTATAAATAGCAAGAGGAAGCGGCAACTTGAGCCAAATACTGCAATAT
TGCTTTTCTTTCTTTCGCTCTCCTCCGAAAGAAAAAAATAGGAAAGCCAG
TCTAGTCTCAAAAAACACAAACGAGATATGGAAAGAGTGACCCCGCACTC
GGGGGACGGGGTCACTTGAGGGCGCTGTACCTCCGGACCCAGAAAGCTGG
TCGAGGCGAAGCTACTTTGCCTCAAGTCTTGGCCGGGCTAAGAAAGCCAA
ACAAGTGGCTGCTCCATATTGATTGCTGATCCAACGCTCCAGGCTGCACT
CGACTCGAGTCCGCCTCACTCTGCACCCTCTCCATCTCCACTTTGCACTT
TCGTTGGATGTCACACTCTCGACCAACACCAAATGAGTTCCAAAAAACAG
GTGCGCACTTGGAGAAAAACTTTTAAATCTATACTTGATTAAAGAACTCA
ATTGCCAGAGCAAGATAACATTATCTTTAAATATTATTAGATTTTTAAAA
GGTATTTAAAGAACTCGTAGGGCTAAAAAATTGTTCATAATTCTAAAATA
CGTTTCAATGTTACCACTTTGCTGAGTGCAACACAAATCTGAACCCTGAC
CCACCTGGTCCGATGCCCAAATGACTTTTACCAGCTGCATATTGAAATTT
TATTGCATTCAGCCCGGAGGGAGAAGCTGGAAACAGGAGAACGGAGTGGA
GGATGAGCAGGAGGTTTGATCCCAGAGCCAGACTTTTGGGTCGCCAGTCA
AGTCAGTGAAGCGGCACAAATTCAAACATTTGTATTGCTGAAATTGAAAA
AGGTGTCGGGATGAAAATGAAAAATTATCCCCCCCGAGGAATGGGGACCT
GAATGGGGCGGCGCAGGGGGCGGCGCAGGGGGCGGTCAGTCTGCCGACTG
GGCAGAGATGATAGCAGCAATGTTTTGTCTTCATTGCCATGGGCCTGCTG
ATGGGATGACCGATGTCTGGCCAACCTGACGATTCAGTTCGGCTCGGTTT
GGTTGGGTTTGGATTGGGTTGGATTGGGTTGGGTTCGGTTTGGCTGGATT
GGGTTCGGTTCGGTTTGGTTAAAACAAGAGTTAACCGTTGATTGGCTGCT
GGTGGTGGCTTAATTGTTATATAGCACTGCGGCAGTGCTGGGCTTAATGA
AATGAAACACCAGCCTTAATTGATCGATTACATTCGCATATACATACGAA
TACGTGAATGATGAACTTTATTATAGAGACTATCGGCCACCGACGTTATA
AATCATTTCGGCATAGTTGCAAGTACATACATTAATACGATACATAACGA
AAATTGTTCGAGTTATATTTATGACGTTCCAAAACTATTAAAATTGGCTA
TTAACAATGTTGATTTATCGGACGGCATCTGCCAATGCTTTATATCAATT
AATTTGTCGATGTCACGGGAGTACGAATATGGCTTCAATTATATTTGGTA
ATTAATACTTAAAGTTGCGTGATTTAAAGGGTTATTGAAACTTCGTATGT
TCGTAGTGCAAGAGTAATTTGTACTTTTACCAAACACTTAATTAATATTT
GTGTTTAATCAACAAACTTTTCAAAAACTCTCGAATTTGTGCATCTTTTT
TGCCGCCATATGTATATCCTTTATGAAATCCCATTTTTGATTGCAACTTT
CTTATTCAGTGATTTCCGCGCGTGTGCGAAATTTATCTTTCGTTTTGACG
CTTTTGCTGATACCACAGTTGGATTTTATGCAAACATATGCGGTGCGAAA
GGCAAAAGTCGCGATGCTGGCTCGTGGAAAAAAGCGTAGACATGCCAAAA
AGTTTTTACCATCATTTTGAGGGCCGGGGGAAACCCGCTCCGAGTCATGA
GCCTCAGCCAGACAGCTGTCAACAGTCAAATATGCAGGCAGCAAACAATG
CAGGACCAGAAAAAGAGTCAAAAATCCTTGCCAGAAGGACGACAAACCTA
TGCGCGATTCCGTTTTCAAATTCCTGGCCGAGACTGGCATATGTGGGGAA
TAATCAAGCCACCGTACATTCCGTTCGGCTTATTTCAGCCAGCTGGTCGA
GGAAGCCTTTTTCGCACCTTTTTGGCTAAATGTATACATGTATGTACGAG
TATATACGTATGAGTATTTAATGGTTCAAGGGAGCGTTTGCTTCAATTTA
TTATACAAGCGTAAGCCCCATTAAAACAGCTGACTCTGATGTCAATCCAA
ACTGAAGCTATGGCTTAAACGAAATTTCAATAATTCTAATTTAGCAAGAA
AAACACGGCGGATGGCTAAAAACGCTGCAAATGTTTACCGAACGCAAACA
ATGCCCACAGACAGGGGATAAAATGAAGGAAAAAAAATAAACAAAAAGGA
ACTGGGGGATGCCACATCCCACAGTAAACGTGCAACTCACTTCTTCGTTT
TGTTATTTTGGCTTTTTCATGCTCCATTTATATAACCAGTGTCGGCTGCT
CTGGCAGCTGAGACGGCTTCTCGGTTCGAGGTTCTGGGCACTGGATACTG
CGTCCTTAGTCCTTGCCCTTAACCCAACGCTGGCGTCTTCGGGTTGGCGA
AGAATTTGACGTGTGCTCGTTTATCATTCATTTTGCGCTCGCTTACATTA
TTCGAACGGAACCTGAAACATTAAATTTTAGCACGTTTTGCGCTAACGTG
CGCTCATTTCTACTTTGGCATTACGACGCACGCCATAATGCTTAGCCTTT
TCCTCGCCCGCTTTTCCTAGCATTACCCATTTTCCTTTTTCATCCATTTG
CCCATCTCCCCATCTTCCACCCCCAAACGCCCGGCTTTTCATGGACTTGG
GCATCAGCCGTAATGAAGTTAAGTGACGGCATTCTGCTGGCGGCTTAACA
ATCTTGTCGGATGAGGCGAAATTGTTACCACCATCGTTGTAAAACAAAAC
AATAATGTCGAGTCTCAAATCCTCGAACAAATGGATTCAAGGATATTACC
AGCACTCCTTTCTCGCTTGGGTTAGACTATGGGCTTTTGAAGGGAACTTT
TAGAACGTGTTTTTAATCCCGGTGCACAATCAATCATTATTTGTTTCCAA
AAATCTGTTAAATCATTTAAAAACGTGTAAGCGATAGACAGAATCGCTGC
ATTTGATTTCTAAGAAAGTATAACCTTTTCAGAATTTATAAATGGTTTTA
TCAATCGATTACGATTCACCCGTAATTAGATGAATATGTCGCAGTTCTTC
GATTGTTTTTCACAAAACTATTTAATCTCCAGTGTCATTTATATTCATAT
TGACCACCAATAACTTTTAAATACTCACGTGATAGCGCACATTTTGTTCA
CTTTATTTTGGTCATAAATTTGTTTTATTAGCGAATATTCATTAAGTTAG
TTGGCGTGTATTTGTAAATGGATTTGCTATTGGCTTATTGCTGTTTGCAT
TTTTTGTGTCACTCTCAATGGGCTTTTATGTCAACATATTTTGGTTTTGT
TTATTGCGCAACAATGTTGTAGAGAGCTCTTCGTCCATTAGTCCGCCCAT
AACGGCTGCAATTTAATTAGAGGGCAGCGGTAATACACCTGATAATTTAT
TTATTTATTACGCACATAGCGAAAGAAAAGCGGAAGCAGCATATGACTTT
AAAAAGCAACCCCCTTTTTGCGATATTTAAAATTCAATAAACATAATTAA
ATGGCCAAAATGCCAAAGGCAGTTGAGAAATCGCTAAAAGCACGGCGACG
AAATCCGAAAAATCATACTCAGAAATCAGAAATGTGAACAGCGGCAGGAG
AAACAACGGCGAGGCATAACTTTTAATGTTTCTAACTACTCGGCAGGCAA
AGTTGCCTTACCCGATCCGGATCCCGATCCCGACGTGCTGCCATATAATG
GAAAACTTGTTTAAAACTTTTAAATTAATTTTATTTTCGCAAGCCAGGCA
GTTCGCCTGCCCAACTTCAGATGCAGCGTTAGATTTAGTTTTCGTTTCGT
ACCATTCGGTTCAGCTCCCATTTCTCGCCACCCATTATTTCCTGTTCCAT
TTGTCTAGAATCTGGATTGCGGATTGTTGGCCCGCTTTTGTCGCAGTCCA
TGTCAGTCCGAGCCAGCAATTAAGACAACACAATTGCACACAAGTTTCGG
TCGCACATCTCCATCTGCAGCTCCATCTTTGTATCTGTATCTGTATCTGT
ATCTGTATATGCATCTCTGTTTCTGGCTCTGCACTCGCATTCGCATTCAT
TGAGCTTTAGATCTCGACCGTCTGCAGTTAGTTATTATAATTGCACTTGA
CTCCCGACTTGGCTATTTGGCTGGGGAAATTGCCCGGGGAGAGCGTCATC
CTCTGGGAATCGTGTTTAGTCTGCATAAATTTATAAATGGCTGGGATTTC
TTCCGCACAAAAAGATACAAACTGTCGCAATTTACTCTTGATCTGCATTT
ACAATAAGCATAAAACAAAAGATTGAGGTCCAAAGATATTGAGTTTTTCG
GTATTTGTGATGACACAAGTCTATCCTTTATCTATAATAACTATTATCAC
TTGTACTTAAATCTCATTTTGTCAAAGTTACCTTGCAGCCATTAAGTTTA
ACCATACATTGTTTTTCCCGGGCATTTGTTCTTAATGACCCACCAAATTG
AACTAAAAGTTATTAATTATTACCCCTCGTAATATCATTAATATTGATGC
ATTAGCTATGGCAATTGAATCGTAATTATTCATATGTAATGAGCTCTTTG
CTGTTTCCCCGGAAATCGTATTGAATTAGATTGACGCAGATTGAGCCTGT
CCGGATCAATATGCGCAGTAGGTCTGTGTGGAAAAAGTTGGACACGCAAA
CATGTCGACCAGGAGTCCTGTGGCAGCAGGATAACAGCAGTTAACCCAAC
CAGCCCCTGGGCGTGGTTGTCTGACCATTTTGGCAGCAAAGGGGGCGTTT
TTCATGTGCGAGCATTTTGTTTGTTGTCGCGGTGTCGCCGTTGACCCCTC
CTCACACCTCCACATGCACGCCTATGTACACAATAGACCCCTGCCAAGAA
GTGCTGACTGATGAAACACGCACAGTTTGATCAGCATGGGCGGAAATCGA
AAAGGGGGAGGGGCCGTCGGACAAAAAGGACGCCACTGACCGACCAAGCG
TTGTTTGCCAGAAACAAAACGCCGGCAAAAAGTTTTCAAACTACATTTTT
CATGTTTTGCGATTTAACTTTGTTGCGATCTCGTGTATACAAACAAAACG
AACTGTACAAATTTTATGAAACTATATACATAACTTCATTAAATGTAAAA
GCATATATGTTCGTTAGCTTGTAGTTTATGGACATAAGGAGTGGAGTAAA
GCCAAATAAATCCATACACTTGTAAATAAGGATGCATCTTGAGAGCTGTT
TATCAAACTACTAAGAAACTTGTCAAATCAAACTGCACATCGATACAACT
AAAAGTCAATTCATTCTTTCATGATTTTTTCTATAATATTTCTCACCGAA
TTACGTAACGCTTAGGTCATGGCTTCTCCTTGACCAATATCTTTTAGGGC
AATGCCAATTAACCAAGTTAATGTCCCAACTTGCTCGAATGGCCAGGGGG
CGGCAGTTGCCTGAAACTTGTAGTCGCACGCCTTTATTAATAATATTTCC
TCTCTTTCCGTCTCATTGCAGGTATGTATCTATTGATGGGAGCACATAGA
GTGGGCAAACGTCAACGTAGCAAAAAGGGCGCCATTTTCCGCTGCCGCGG
CCGGGCTCTCATCTTTCCATTTGGCAGCGGAAAAGTGCGGGGCGAGCGAG
GGGCTTCGCAACATGCTGTCGTTATGGCCAAGGCGACAGTTTTCCGCTGC
AGCAGTCTTGCTCCATTTCGGCTGCACTTGGTCTTTAGTCCTTGCCACTC
GACTCGCTGTAATTTCTTGGCGTTTATTTTTGTGCTTTCTGCGGTAAGTT
TTTGCGCTTGCCGCTTGCCGGTTGACAAAGTTTCAAGTGTTCGCTTTCTA
ATGTAATTAAAATGCTTACAAATGTTTGCCAACAGCGATAAAATAATCAT
TTGAAGCTGCCAGTAAAAGGGAGTAAAAGGGAAAAGATAAGGGTGGCTGG
CAGCCCGAAAAAAAGGACCCAAATAGAATTATAATTTAAGTGGAGCATGG
CAGCGTTATCAACATCTAATTTGTAGCATCAAATAAAAATCAAATAAAAT
TATCAGTGCAACGTGTGAATGCTTAACAAATTGACGAAAGCCAGGGCTCC
GGGTTCAGATACAGATACAGATACTTTCTTCATACACTCCATACTGGCCG
ACCGCCACACACGTGGCGAGCTGCGACGCCAGCTGGCTGCTTCACTTGGT
CTCCCAGCTCACGTAGGCGATAATGTTTGCCTGCCAAGTGAGTTGGGTAC
TTGCGAGGATGGGGCTGAGGACTTGAGATCCTTTGGGCGAGTCAAACGCC
CCCAGGCTGACACGTCACGTTAAAGTCGAGGCAAAAAATGGCAAAATAGT
GCGACGTGTTTTGCTCTGCTTTCTGTGTTTTTGTTATACTCGCATAAATC
CTCTTGTTTAACATATGCAGAAACAAACATATCCCCATAGGTATAATATA
TATATATACTATGCATGTACATAACTTTCCATAGTGTCACCATTTTATAT
GCGATGGCCAGGAAAGTTTAATTTTACACATCGCTCGTAGGCAGACAAGC
AATGCTATTTATTCATTGACTTGCAGTGCACTTTCCCCAAAAGTAATTAA
ACCAATTTGTTCATTAAAACTGACCTTTTATTTATAAATGGCTCAACATT
TCAATTAACCATTGACAATATTATGCAACCAGAGAGGCAGATATAAAAAA
GTAATGAATGCGTATAACTGAAATGCTGTAAGTGGGCTCCTAGCATAAAT
ACCGGAAAATGGCAAGCAAATTTTTAATATCTACTTAAACTGTTAAAATT
AAATTACATTCATGATTAAAACTTGTAAAGACACCGCTAAAAATTACATT
TCATATACAAATTGTTGAAAATATGGCCAAATGACTTAATTCAACTGTCA
CACAATAATAGATAAATCTCTGCATAATGCTGTACTAATAAAGCACACAC
GATCCTAGCTGATAGAACGGTTGGCGTGCAGAGTGCGTTATATTTATAGT
TCACTGTAGCGGCCATAAACCGATTTCGAGTGCCAGGCCGACCTATCTCA
GGCCCACTTGGCCACTCCACCCACTCCTGTGGCCATTGTCACGCAACCGC
AAAACAAAGAGCGGAAAAAATGGGGAATGACGAAAAAACGACCATAAAGC
TGCTACAATGCCAGATATTTATCTGGCTTTATTGACAAAAGCGTTTTGTC
GATTGTTCAAATAAATTATGCCTTTATCAATAAAGTCTAGGTTCCCGATC
CTCGTGCCCACCGCATTTCACCCGCTTTCCGCACTCATGGCTGTTGCTAC
GTGACGTTGGCCGTAACTGGGGCGAAGATTTGTTATGGCCATAATTCAGA
GCAGGCCAAAAGGAATGGCGGCGAGGACGCGAGTGGCAAAATCCTAAAAT
CAAGCGACTTTTATGCGTGCATTTATGAACTGCGGTGCGCAAAAGCTCTA
TAAATCTTTAAGCAGGGGTGCTGAGAGTCAGGCAAATCAAATATCAAATT
GTTTAAGTGATTTTTCATTTTGCGCTTTCACCTTGTTACCGGTAACATAA
TTTCAGGGCAACAACTTCGCCCATAAGTGATTTCAACCACCCAACCAACC
ACTCGCACCATTCCTTACCATTCCATGCCATTTTTTCCATCAAGTATATT
TTGTTGTTCCCACTTTGATATAGATTGTTCGGAACAGGGAAGTACTGGGA
TGTGCGGCAGCAGCCGTCATTTAATTTTATCGTGCGGAAGTTCTAAGTGC
AACGAGCTTGTTGTTGTTTCTGTCAGGTGGGGTGAGTGCCACCGCCACCT
TGAACATTGCTTAAAAGCCCGCTAAAATGTTCAATTTACGTGTACTTCTC
CTTATTTTTTTTTACAATTATATGAAACATTGAAAATAAATTGGAACTGC
GGGCTGTCTGGCAGCCTGGGTGTTCGACTTTCCGCCCTCGAAAAGTAAAT
AAAAAGGCTCGCTGACAAAATGGGAGCCCCTCACATCGCGCTGTTTGCTT
CCACAATATATAATAATAAAAACTGTATTTATTTATTATGATTTTCCATT
TCGTGCGGAGTAGACAAAAAAAAAAAATGTTTAAATTGGCACAAACTGTG
CCCTTTGGGCGCTTTTCTCCATTTTCCTGCGCCCCTGCAAAAACATTTGT
TCCCTTGTTTAACAACGGGAATGAATGAATAGGGGACTGACTGAGTGGAA
AGTTGAACAGAAATTAATAAAAATATTTAAACTGTCCTCGGGGCCAACGA
ATGTGGAAAAAGCCCAAAAGGGAAAACAATGAGAACTAAGTAAACATTGG
TCACATGATAATGTTGATTGCAGGAATAGCATCGTGGTTTGGTGACCATC
CCGAAAAAATGGTTCATCATTCAACTCTTATTATTCCTATTTCGCTCCAA
AGAACTGCAGCCATAACAATAAATGAGCTCATTGCTCATGTCGGTCGGGT
ATAAAATGTAAATTTCTGTGTATCTATCTATCTATGGCGAAATCCGGGGT
AAAATATAAACCCCAAAGTTTCGCAGCGCAGCGAACATATATCAAACAAT
TTTTCAGAGACTGGTTCAAGTACAAAGTCAGTTCAGCTGCAGTCTGGCTT
CTTCGCTAGTCATACATTTATGGACGTGTCCTTAGCAGCACTAGGAACTC
AATAAGCCAGGCCACAAGTTCAGCGCAAAAAAACAGGGCAAAAAATAACA
GGAGAGAGGAATCGCTGCAAAAAATATACATAAAAATTGCGAGCAACAAG
AAAAACTTTCAACAAATTTCCCCGCATTTCGTGCGCATATTTTAACTACA
GCGCATTATGTTTTGAGTGATTTACGGTCGCAGATGGGCGGGAATCGAGG
GGTTGAAACAATGAGAGGCGAAAATATGGCAAATAAAAACTAAGCCATCC
CCTCTGCCCCTTATTTCTCCACTTGAGCAAATGATTTGCGACGCTGCGGC
GGCCAAGGCGAAATGCTAATGCTTAGGATGCGCAGGAAAGTATGCTACAC
AATCCAGCCGACGAGTCTAATGCTGTCGTAGTTGTGTTGCTGTTGTTGTA
GCTGTAGTGCCACTGCCATTAGTGTCGCCAACTAACTTTAGATAACTAAT
TAGGGAACGACGGCCAGAGCCCGCTGACTTAACTGTAGTTCTGTGTTAAC
CTTAGCGCAGCTAATTACATTTAATGTGTCTAGTAAGCAACTTGGCAGCG
CGAATTGTGTTACTTCGGTCCAAAAGGAGTGGGTTACAGCCGGCTTATTA
AAACACTTGGAGGCGGCACGTAGAGTGCTCCGGACTCTGGAGCAACGTGT
GCTCCGACTTAATTATAACTAATTTGTAGCATATGTGGAGGCAAGATGAG
GCGGGATGAAAAAGTGGCCGGAACAAACCTCAACTTTTGCGGCTTAAGTG
GCCATTAAAGCATTAAAGCCATGGCCGAAGTGATACAGCAATTAGCCGGG
TGCACGTGTGTGTGTGTGTGAGCACTTCGAAAAAAGTGTACATTACATTT
AGGAGAGAAAGCATGAGAGAAAATAACCTATTTTCTAATATGGAAACATT
AACATGAAAAACCAAGATTTTCGTTCTGTGTCAGATGACAAAAGAAAAAA
AGGGCATCTGTTTCACGCTAATCGCATTTCACCGCCCATCGTGTTGGCAT
TTGCATAATTATTAACGTTGATTTTTAAGTGGGATTTCAATTTAATACCC
CGCGCATACCGCCCACTTCCGGACTCTTTGGCAAAAACCAACTAACCGAC
CGACAAACTAACCAAGTGAACGAGCCACCATCCAAATGATTGAAATTAAA
ACCACAAACGAACATAAAAAATCGCTTACGTTAAAAGCTCATACAAGAGA
GATACGGTGGAGAGCTGCTGTTGGTTGGAAAATCGGGAAAGCCGGGAAAC
AAAGGAAGGGCAGGGGGATTGGGTTTGCCGGAAAGCGGCACCACTCGAAT
GAATTCACGTAACCGCATAAAATCAAACGAAATAAGCCAAGCGCCGTGGA
AAAATGGCAACAAAATGCACTTTATGCGAAACTACAAGGGAACAACTCTA
CGTGCCACTCAACACCGCGCCCTCAACCCACCCGACACCCACCCACTTTT
CCGATCGACTGAGAGGTGTAATAATGGCCAACGGCACGCACATTGGACCA
ACCACAAGACCCACGGACAAATGTTCCCTACGGGCTTCCATGTTCCCAGG
TTCCCTGTTCAGTGGCCATCACACAATGCTCAAATGCATCTGGGAAGCGG
GGTAGCGGGAAAGCGAGGAATCGGGGAAGCCGGGGCAAAATCCAGAGGAT
AGTGAGTGAAAAAAAGTGGAAACTTTTAACCATAAATGTAGGTAGCCACC
CGAAATGGGCAGCCGAAAAAACACAGAGGCAGGAAGAAATTGCCAGAGCA
AATACGAAAATCAAGTTTAAATTTGGTGAGCTCGAGTGCGAACACAGAGT
GCCGGATAGCATGACATTGGGTTTTTGGGCTGGGAAAAGGGGTGCCTCAG
GTGCCCGAGCAGAAAATATTTAATTTTCCAGTAGTAGTGAACCGAGATTG
CGTTAAAGTTTCCATTGCAGCTACTCCTGTTTAATGGCTGAGTAAATGCA
GCTCTGGGAAAATAGTTTTTCAATTTAACAAAACTCACCGAAGCTCATTT
GCTGCATTAAATCCAAGAAAGATTTTAGTAATTAACTTTCGGGGGGGGGG
GGGAGAAGCTAACTATGACTTGCCACTAATTGAAATCCGAAATCAAAGTA
TCAACGATAATAAGCCGAAGCTTAAGCTTCAATTCGTCATCTCGAAACAT
GAAATGCATTTGAATAGTTAACTATAGACAAGCCTTTAATAAATGGCTTC
ACAAAACCCTATAAGTAATGAACAATTAATCAATCAATCGGTGCTTAATA
CCCTTTTGTGTCAGTCGCACAAAAGCACATTCGTAAAACCAAATTATCTT
CAGGTGCTTGAAGGCAGTCGCCTGAAGCATTCGAATGAATATTGCAGCCG
AAATCCCAGGCTAATGCCAAATAGTCAAATTCGATAAACATTGTGTGGGC
TCAGTCAATTGGCCATGGACAGATATCAACATGCAACGTGCAACATTCGA
TGCCGGTGGCAGATGACACGGCAGGCAGCAAAGATTGCTCCTCCCTTGGG
CCGAATTTGCTTGCATTTCCAATTCCGAATGCAACTGGAGTAGAAAGACA
ATAACCCAAATGCAACTGCCAATATTAGTTACGGTTGGCAACAGCTTGCC
TTCGAATAAAATCGAAAAATGCTGAATGGATTGGCTTCGAGTGGCTGTTG
GGGACGACAGACGGAGTTGGCTCTGAATAGAGAGTTGGGAAACGACATAA
ACGACATATACGTGACAGAATTGCAACACAAAAGGCGCCGGAACGGGCGA
GCACTGACAGCCAACCGTCAAAAAGTAAATATGCAACAAACAATAGCATT
ATATAACTTAAAGTGCACTTCGCTGCTCCAGCAGCTTCACAACTGCCAGT
ACAGTACAATGGCTCGGAAATCGGATTAATGCAGCTGCTGCTCATGCTGC
TCTTGCTGCTACTACCGACGCTCCTGGTGAAAAGCGGGGAAACCCAATCC
GCAATCCATAGAGCTGCTTCTCCGCTAAATACAATGAAAAACTTCCAACG
AAAGACACACATTCGCACGGACTCGCCTCTCGCATGGCAGGGCCAATAAA
CAAAAGGACAAAAGCGACGCGTCGCGCCGCCCCAGAGCCAATCAATCGCT
ATGGCACCCTAGGGGCTCAGAACCCCATCGAAAAGGGGTATGAAAGGGGC
TAGGGGGCGTAGGGAGCGAGGCGATTGAACGCAATCTGACACGCGACCAG
TTCAATGCACGTTGCCCCTCGCATAGGTCAAAACCCAAAGGCAAGAGCAA
AGTAATAGATTTTTTTGTACAAGAACGGAAAAATGAAACACGTGAAGGAA
AAACCAGTTCCGAAATCCATACTTTTGAAATTTTGAACTTAATTTGTTTT
TTGGCGCCCCACGTGGGGCATTTTAGATAATGAGTCTTGCGATTATCTGT
TAAATATGACGAAACTACTGTTATAATCATCATTATTTTTAAAAGTCTAT
TCCATTTATTTATTTAATCTTACAGATTGAAAATAATTTTTATTCACAAT
ATAATTGTATTTTCTCAGTGTAAAACATCGGCAAAGCACATTTTCTTACT
GATCGATAAATGCATATCCTCTAAAACCATAAGCTACTCAGCTAATTCGA
TAAGTGCACACAATTTAATGCAATCAGAGCTTACAACTGATGATGACTTT
AAATTCAAAGGTAATCGGAACTAAATCCGAGACCCCCTTCAGCTTCGATT
AATGGTGGTTCATGAAATAGGTTTAGGTCTCAAATCAAGTGCATCGAATG
TTGCCCCAACTTACCCTGCAATCGAGGACGGGTCGTTGTCTCTAGTCGCC
TAATTCAATTACATAAACCGAACCCAGCAGCAGACAGTATTCGGAAACTT
TAATTTGTATGCAAAGTCAATGCGAGTGAAGGGGAAATCACTGGATGTGA
GGGGAGAGGGGCGGGACGTCATGCCCACACGTAGACGCATCGCAGTACTG
TCATGTCCTTGCGCACTGAAGCGCTTAATCCTTTGAAATTGCCACGCAGC
ACTCGCATGTGCATGAGTGATGCGGAATGTTCAGGACCCCGGGGCGTATG
AATATTACGCATACGCCGCGTATGCGTCCACTCATAAACAAACTAGACAG
CGAAATAACATTCAATTTTATGCAAAAGTGTTGCATAATAAGATTACCAG
CGCTAACTGCCGGGCGAAATCAGTTAAAAGCCAGAAAAAAGATCAGCAAA
CAGAGCCCCTCATTCATTTACAAATAATATTCGGCATTAAAATTGCATGG
CATAAGCGGCAACATGCCACCGTCCATCGTCCCCCGAGCTGAAATATTTT
TCTCATTTCCGCAACGGGCGAAACATATTTTTGCGATTTCCGCACGGCCA
TCGCCGGGTTCCTGGTGCCTGGTGCATGGGCCCTGGATCCTGCTGAATCC
TGAATACTGAATCCTGGTGCGGCAGCCCAGCATGAAATATAAATACAATA
CAAATAAACGCGTGTCGTGCATATTGTACAATCTACAATACAATGTTGTA
TTTATTTACACGCCAACAGCAACGGCAACCAGCAAGAGAGCCAGAGAATC
AACAGAACAGAAATGGCAACAAATGTTGGCTATTTGGTTGTTCGGCGCTT
TTACTGGCTGGTCGCGTTAACAATTTGTCAGCCACCCATTTAGCCAAGTT
AGGGCCACATAAGCTGGGCCAGAACAACGACCTCGCTGGAAAATGTTTGC
AAATGTGCTGAAAATTTGTCGCGCGCTGCATTAAGCTCGTGTGCACGGGC
CGAAACACTGGAAACAATAATAAAATGGCACTATAAACTATCTGGTGGAT
GGGACAAACAAGAATAGGGTGTATTATGTGGGCAGGTCCTGGTGGCTGAT
TTAGATTTAGATATTTGAGCAAAGAGAAGCAAGAATTCCTCGGGCTGCTA
ATGCATACTCCTGCTTTTATTTAAAATGCACTTACCCTGTTTTATATTTT
AGGTAATAGTAGAGATGTATACTTTTACTTTTGGATATTCTTTCCAAAGA
ACGCATGATTAAGTAGGCTTTAACTAATACTGCCAGATTTTCTTGCGAAT
AAGCAAGTTGTCTTCACGTTTTTGATGTGCAAATATGAGTCGTCAACTTA
GGAAATGTGCTCGAAATGATATGCATATTTCTGCTTTTCGCATAACCCCT
TCGTCATTCCATTTCACTGTGCTCCTTGCAAAGGAAGCAGTGCAAAGGGC
AAAGAGCGCTGAAGCAATGAAATGAATTTGCACGCGCTCATAAATATTTT
ACATATGCATATTGGCCAACTCAGAAAGCCGTAACTCAGTTCGCAACCTG
AAGATGCTGGCTGCAGCTACGTGAAATGAATAGATAGACACAACACGGTC
TCTCGGAACGAGGCTGCAAATTATTGTGACATAAAGTGCTTTGACAGCAA
CACCAGTTCCGAGTTCACAGGACCCAAACTCCAGATCCATGGCCAAAGTG
CACTGTAAGAAATATCTAGGTAGGATTGTAGACATCATTTGTCATCAAAA
GTGCTTAAATCAAACTAACTATTATACTATTTCATACATTTTCTAAACCA
AAAGAAGGTCTTTAGGAAAGGTGGGGAAAGCATATAAGAACGAATCGTAC
TGTATGAACAAATTAAATAAGTTTAAATTAAATTAATATAAGTAAAAAGT
TTGAAAAATCAAAAGAAATTTTGAACTCTTTAATTCATTGCTATATTCGA
CACAACACCATTTTCTGGAGCCTGTCTTTTTTTTATTTGCGTGCAGATCC
TGGGCATCCACATCCATATCCTCATCCACATCCTGGCTGACATTTAGCTG
GATGGCGCTGCTGTTTGTGACATTCATGCGCTACATATTTCATTGCACAC
TTGGAGGGGCGTGTGCCGGCATTGGGAATTCAAATGCTGAGCCGTGTGAT
TAGGCGGGGTGTCGTCGGTGTGTCGTGGTGTGCACATGACATATTTAAGT
GGGTTATGTGCCGGCAGGCAGTGCGAACATTTTTGCTCATTAGGCCGGGG
AGCGGGGAACGGCAAACGGTTGTGGGTGGTGAAAAATATCGAGAAGATGG
AAAAGCTCGTAAGTCCTCGACAAATGCAGCACGCACTCGCATAGACAGAA
GCAATTACTGTCTGCGTAAGCGTCTTGGTCTGGCAGAAGCCTCGTCCTTA
TTGGCTCGTCCTGGCTTATATGCATATGAGCCAAATGCAAATTTATCCAG
CCGTATACGTTTAAAGCGATTTATGCCTGTATCCCAGTGTTTTTTGACAG
CATAAAGTGTGAAACTAATTACAATTTGGCCAATTCATTCAATTAGCACA
GACCGAGTGGAGGGGCAGGCTTCCACTTAAATTGACGTCTCGATTTAATT
ACCAACTGTGAGTGGAAATTTTGACTTTTGCCGGAAAGTCTCGATTTATT
CATTTGGAAAGCAAGCAAGCAATCATCAAGGAATCTCTACCGCTGCATTG
GTGATTAATCACGTTGCATAACTTGGGAGCCCCAAGTGTTTTTCCTATCC
GATTTCGCAACGAAATGCTGTAACGTAAGCTAATGAGATCAACATCTGCC
CATTCCATTCGCTTACGCAAATCACTTAAGACGGCGGAGACAACGCCGGG
GCATTTTCCTATCCTTCGCCTTTTCCACGGACTTTCTCGCGATTTCCTTC
TGACTTTCCTCGCACAGGACACTTTTCGCTTCGTGACGGCTTAATTTTTT
CGTTATTTCTTTCACTTTGCCTGATCCAAAAGCAATTATTTTCCATTCAA
CGTAATAATGACGCAGACCCAACGATAACAGCGAGTGTCCTGTGCGGCGT
GAAAGTGAGGGGAGAGAATTAAATTATGCGCTGGACTTTATTTTTTGCCG
ACTTCTGAGGCTGAAGCCGCAGGCGCAGACAACACTTACAACTGCCGTGT
TGCTGGCAAAAAAAAAAAGAGAAATGACATTAAAAAAACAAACAACAAAT
ATTATGAAAAAGAGGAGGCGGTAAAAAAATCGCACAACAATAAGTGCTGG
CGGCAATCTCGCCGTCGAGGTTTGTTGAATGTAGCCATAAACCGGCTCAG
TGCACTTGATCGACGGGGAAAATGGCTTTAGCTTTGGCTTTCGAACACCC
CGTTATTCGCCCTTTTAGGCCGGGCTAAAGTGTACGCCTCGGTGACTTTG
TATGCGTCTATGAGACCCGCTCGTCCTGCGTCCCGCGTCCTTCGTTTGTA
TACACATACATACTAACATATATGCTGAATAATGTGTGCCATATTTTGTA
CGTATTTTCCGCTCCACTCTGGCATTATCCGATTCGTCTGCTCCACACTC
CATTTCTATGGCCTGCACATTATAACAAATTTCCCGCTTGCATAAGCAAC
ACACTCGACATGCATGTGTCGTGTGTGTGTGTTTGTTTTGTTTGCTTGTG
TGGGTGAGGGAGTGTCCTGACGGCTGCGAGCCGTGCGTCCATATTTTTCA
GCGATGTGTGCGTGAGCAGAACAGCACAGGCTATTCAAAAAAAAATACTT
ACTCATGAATTTTGCTGTATTTCAATATTCTATAACTATTAACAAAGGTG
CAAGAGATACATGTTAAATTTTTGAAACCAACCATATGTATATGTGGGCA
TTGTAAATTATGTTTATGTCATCCCTTATATCGGCACATCTTTATTATCA
AATAAAGCAGATTTCTCCCTTCTTCGGACAATCCAATCTGTCATCCTGTT
CTAGCTTATCACGCACCCATCTCTAATGGGATTGTTATGTAAAGCACACA
AAAAGCTGCTAGGCTAGCCTGATGCCATATCACTGCATAACAAATGGTCG
CCACACATACACATATACACCCACACAACCACACACTCGCACTTGGGGCA
GCAGCACAACATGCTTAGAAGGAAAGGGGGGGAGGGAGGCACTGCCTGAT
GGCGGCAGTCCATAAAAATGGAACGGAACTGCAAGTAAATTAACAGGCAG
GACGCACAAAGATGAAGGCGAAGGCGGTACATCCTGCGAATCTGCATGTG
TGAGTGTGCGAGACTTTACATAAGCAACACGCCCACGCTTTTTGTAGACC
ATTCGAACGCCCGTTCACCCGCCCACCCGATTTCCCATTTCCCCATCCAT
TCGCATGCCGGCTACTTAAGTTACACAATGACATTTTTCAATGTGTCAGA
ATTTTATTGTTGCAACTTGGGGCATTGTTGTTGACAACTGACATCTTTCT
TTCTGCAGCTGTCAGTTGGCTGCTTTTGTTGCCTTCGCTTCATGGCTGCT
GATACCGTAGAAGCTGTCGCCACTGTTTCTGCTGCTTTTGCTGTTTTGTC
TTGGCTGGAAATGTTGACAACTGTTTTGCCACTTTTGCCGTAATTGAAAA
AATGTATTCAAATTCACTGCCTCGGCTCGGTGTTCGAGTTCAGCAAAATG
TAAATACAGGGCTGATAGCACGTAGATTTGTATATTCAGCAGAATAATCA
AATGGTGAAAATAAAACACTTCCAAGGCTGCAGGGCAAGGCAATATTTAA
AAACAAAAAAATGTTCAAATAAATTGCAGTTGCAAGAGCAAAGATTGGCA
CTTTAAATTATCTATAACAATGTGCACAGCAATGTTTATCTTTTAAGTAT
CAACCTTTGGCTCAACCACTACATTTATTCGAAAGTTTGCTTCTCTGATT
CGGATTCTGATTCTGAATCCAATTCAATCAGTTTTAAGCAAACAAATCGG
TCATATTTATTGTATTTTGCCTTTGGTCTCTTCTTTATGATGCGGCTGCT
TTGTAATTTGCCAAAAATGTCCGTAAACTTTGCCCAAGAAAGTGACGGCT
AAAAGGGGTCGTTAATGGATTAAGCCAAGCCGTACAATGAATAAATTTGT
CGGATTGCTTGACAAGAGAGATGGCAGCCACAAGAACGTTTCTTTGCAGA
TAAAGCCCTCCAAAGTTGCAAAGCCGAAAAGGGGAGAGTCTGGCGCAACA
TTTCAATACTTTCGCACTCTTGACATTTCCGCCGGTCCTTCTAAACGGTT
GCAAATGCCAACTGTCAACTTTTTGTGCGTGGTTTTTGTTTTGAAACTTA
ACTTTTGCCGCTTGGCCAGTTCGCAAAGGGACAAACCGAAAATATTTGCC
ATAAAACCAGACCGAATCCACCCATTTAGACCCATTCAGTTGGTGGCCAC
TTTGATTCGACTTTAAGCTGTGCGTGGGCCTCAACTGCCGGCCACTCTAA
TATCCAATTTTGCAAATCAGCGTGCAAATTACCCGAGCGAACGGAGGCTG
ATTTGTTGAGCCGCCTCCTCCCGGTAATTTGCCTTCTGGTCCATGTAGCT
GGCAACTGTATTAAGTTCATTTTTCATCTGCCGCTCATGCATTAAGCAGC
GAAGTGAGTTGCCTCCAGGACTCACACAGATACTCACGTTAAGAGAGAGT
GTGTATGTGTGTCCACACACACACTACCACATGGCGAGTTACTTTTTCAC
TTAGGGTCTTTGTGTGCTGCCTTTTGGCATGCAAATACATCGGACAAGGC
AACCCGAAACCGAGACCAAAAACCAAGCCAAGTTAAGCCCAACACGTTAG
AGAACACAGCGCGCACAATTTGCTAGGAGCCCTCTTCTTGCGTCCCGCCG
CCCCTGAAACAATAAGAAAAATGTTCAAGTGCCAGAATGTGTGCAAAGAA
CTCAAGTTTGCCGCACACAAACGCGCAGAGCAGGCAGGACGAACCAGCAA
GGACCAAGGAAACCAACTCCAAACTCCAGCTTTTGGATCGTGGGTCCGGC
TGCAAGTCCGTCTGCATCTTCAGCAGTCCGTACAGAGTGGAAAACTGATT
CGCAAATACAATGGAGCCCTTTTATTGGACTCGCTACTGTTATACAGTAC
AGGTCCTTGGAGTCCTGAAGGCGTTTTATTTCATATATTGTAGTACGGCT
TCTTAATGAATCCAAAGCAATTGAATGCAATCGTTTCGATTTAATGAAAT
GAAATGTTTTGAAAATATATAGTTAAACAAAATATATAGTTAAATTTAAT
TAGTACTTGATCCTAGCGGATAAATTATACATATATCCAGTCCCATGTTT
GAACCAGACTTTTCTCACCGTGCATGGCATTGTTTCGCTGCATTTTCACC
CATTTCGCCGCTTGCAGATAATTTGAATTTTTCCCATTTGCCTGGCTTGG
CTGTTGCTCCTTTCGAGAGGTCCTGCTCCGTTTTGGGACTCATTCCGCGT
CCTGTTTGCTGGTGGCAGGTCAGTTTCGGTTCAGTTTCAGTGGCATGCCT
CGCCGCTTTGCCTGTTTTAAGAACTGTAAATTGCTTTAGTTGGCGCACAT
TTTCATCGCGAAAAGCGAAAAGCGAGGGAAAGCGGACTGCCGTATTTATG
GATGCGCGGATGGTAATAGCACAGTGGTTCTGGGTTTTGTTCCTCTGCCA
GTTATGCAGGAAACTTATAGCATGTGCTTATCTATGCAATGGAATGGCAG
TCAGTAGTTCTCCCACTTTTTGCCCTGTTTTCTTGGGCCCCCTTTATTTG
CTCACAGTTGCACTTCTTTGGCACTCGAAAAATGTTTCGGAAAATTTCTT
GGGCCAGAAGTTGGTGGCGGTGAGAGCTGCTGGTGAAAATTAATTTTCAG
CTCCTTCCTTGTGGGTTGGACCCTCAATAAATATTCCATTTCGATTCCTT
AAAATGCATAAATTCCATTTCTGGTATTGTTTAAATTGCAAGGCAAGCTA
CTTGGCAATTTAGTTACAACTCTTTCCCCAAATATAAAATTGATTAGCAG
CTGCAGTTACTTAAAAAAGACTACTCTGCATGTATGCCTTTAACACAAAA
CTAAGAGTGTAATTGGATTTTTAAATATGTTTTCTAACTTCAAGTTCCTC
TAAAGGCAAATTTGTGCCCCTATTTTATAATGAAATGCGGTATGCAGTCA
TTTATATGGTTAATTGTCCACTGGATAAGAAGTCCACTTTTCGGGACAAT
CGCCTACGAATGCAGAATAGTTGCCGCCTCTTACACAACATGACATATAA
TGCACTTAAAACTTCAGAGATGTCTCGTCAATGTTTGAATATGGCACCAG
CAGCAAAAGTTGCAGCTGCAGCTGCATATGCAACTGCAACACCCCACCAG
CGACTGGTGGCACTTGCAACACGAGCGGCGGCGACTTGAGTGCAAAATTC
AATTAACTTGCTTAAGCACGGACACATGCAAACCACACACACACTCCAAA
ATGCACATGTGGGTGAGCTATCAATTTCATGTCCAATCAACCTGGCAGAC
AGGACACACCACACCACATCGTCTCACCCACCTACCCACCAGGCCACTCT
TCATTTTCCGGGTGGCACAGGAGCATCGGAATCTGCTAAAGGCCAGGTGC
ACTGCCATGGCCCAAAACCCCGGGCCACTTAAGCAGATGTCAGCTTGATT
TTTGCATATGCGACAGCACTGGGAGCTCCAAACCTATATGTATGTATGCA
TATACAGCTCGATGGAAAAACCTTGGCGTGATTCCATACTTTTCCTGCCA
CAGGATCTCGACCAGCTGCGGCGCAGCTCCTGCGTGTCCTGCCCAGTCTG
CTAATTGTTTTGCGGTTCATTGTTTAATTATTATGTGTGTGTATATGTAG
TACACGCGTGAAAAATAGTTATGTAGTCCCTACAAAAGAATTCCAACAGT
ACAAGTTATCTCACAAGAGTTTTAAGAAGAGAAACTCCTTAACATAAGTA
AAATTCATGAGAAAAATACTTACCTCTTTTTGATTAGCTTAGATCTAGAT
AGTTAGTTAATTTCTGTTTTTCTCCCAGTGTACCATTGACTGTTTGTTAT
ATTTAGTAGAGTTCATTGCAAGTGCGGTGTTTGCAGCCAGATGGCTCCGG
CGAAGTTCTGGCCGAGCTCTAATTAAAGCGCTTTGCATAATAAATCAGGC
GTGGCCTGCGACTATAATTGTGGCCCCGCCTGTGGTCGCAGCTGTTCGTT
GTAACGGCGTGTCACTGCCAAATGGCCTGTCAAATAAGAAGGCATTTTGT
CCAAATGTTGCCGTTGCTAGCACACGAACAACTGGTTGGGCAAACAAGTT
TGACATTTTATGATATGACCACACTGCCATGCAAACCCCCCAAAAAGGCC
CACCCCATGAACCGTGCAGCCTTCCTTGGCTGTCAATTACATCAAAATTG
TGAATTTCTCTCGTTATGCATTTGACATTTTCGACTCAATATAAAACGGA
AATAACTCACAAAGTGGAGCTGGCTACGAATTCGATCCGATATATATACA
ATTGAATCTGTCAAACAACGCTCTGTACACCTTTCGCATGCCATAAATAA
ATAATCAATGGATTTGTGCCCATTTCAAGTCGTAGCAACCTCGCAACATG
CGGCGTATACGTAATATGCACAGCAATTCGTTTGCCTTTCAAAGGATAAT
TTCACTTTGTTCTGATTTATAAAACGGGGAGTGACGAAGAAAGAATGGAT
ATTGGAATTCTAAGCATCGGGTTGAGTTAAATTGAATTGAATGTTTAGTG
CTCTCGATAAGCCGTTAAGCCTCGGGCCAAAATAGCTAATAAATGAGGGG
ATATTAATTCATCAGTTTCGGCTTAACAAGCGTACATCACACATTCTACA
AGGATTTTCAGCGCCACGGGAATTCATGTTTAATTCACAGTGAGATTGGA
ATTCATTTGAGTTCGCTTATCTCCCCAGAAGGCTAAAACTTGGCTTTGGC
TTGCGCCAAAAACTGCACTCAAAGCGATTCGACTTTGTGACCAAACTTTT
GGCAAACTTCTCGTTGGAGAAAATAGAAAAATCAACACCAGAAATAAAAA
TGCAAAGTAAATATGAACACGCAATGCCAATCCCCTGCGAATAAATTGGC
AAGTGGAAAATGGAGAGAGATAAACTGAGTTGAAATAAATGCTTTAAACA
AACATATACAAAAAAGTCAAATTCTGTGATATTCACATTTTTATTCTAAG
CAAAAATTCTTTAATTTAGTTGTCAGTTCAATCGAACTTGGTGCTTAAAT
AGTTTTGCTCCTAAATACCTTTTATGCTGCTGCCTTATACCAATTTCATT
ATCCTGTGGCGGGACAAATGCTATCCGCTTTCTTTGGGATTGGCTTTCGC
CCACCAGTTATTTTTTCCCCCCGGCTTTGGTTTAGTTTTTCTCCCATTTC
TTTTCACCTCCACCAACTGCAAGGCAAACGAACCGAAAACCCAAACAGCC
AAAGGATAAAGCCGAGCAGAATGAGGCAGGCAGCACAAACTCGTGTTAAC
TACACATTTGGGTATTTGTGTATTAACACTTTGCCAGGGAGTCGCACAGA
AGGATCCAGGACTCAGGGCTCAGGACGCAGGACTCGGGACTCGGGATCCA
GTGGAGCAGGATCGGGAGTCGGGTTAACACAAACAGACAGTGGCCAGTTG
GCAATTCGACTGATGTTCCTGGGGTTCAGGGGCTAAAGTTTAATTGGCTA
GTTTAATTGTCAGAGGGACTGGCAAACACCCACACTCACACACACACACT
CCCACATTCACACACACTCCCCAATAAAGACAACAAAGAAATTTAATCAA
GCGACGAACAATTGCAGGGGAACATAAATAAAAAGTGCAAACGTTTATTG
AGTTTAACGAGCGCCGTCTGCACTCAGTCGCTCTTCAATGCCTGCATCTG
TGTGCGTGGGCCGCTATCTGTGTGACAGTATCTGTGTGTACATGAAAGGA
CTTTTAGCGATGATGATGGGGTCGGGGATTGGGAAACACCAACACCAACA
GCAATAGCAACAACAACGGCAACGGCAGCAGCTTAATTTAAATGTCACCT
GCACTAAACAAATACGCCAAAGGGGCGGCCATCGGGGGGGCGGTGGACAA
ACAGAGTATGATATTGTTAGTGACACTCTTTCAGCATTAAGTGTGTACAT
GACAAGCACACCATCACACACACACACAAACACACCCATGCGGGACTACA
AACAGCATTACATATGGCCAAGTCCCGGGAAATGCACTTCAGAAGCCACT
CAACTCATCGAGCAACCAATCGAACAGATAAACAAGCTCACAAAAACATT
TGGGTGGTATTTTCCGAGTGATAGGATAGTTTATACAAAGATACGCTTGC
TAAAGAACCAGAAGAGTCCAAAGTAAAGATCTACTCTTCATATGAATAGA
TACATTATTATAATGGGCTTGAATAACACGTTAGTAGTGTTATTGTACAA
AAACAGATATTTTTTAAGCTGGTCAGTAGATTGACGCCATCTTATCCATT
TTCTGCGCTTCCTGCAGCTGCTTAAATATTTAGATTGCATGAAATTAAAA
TAAACAAAGTCCCTTGAGCAGGACTTCAGCCAGCTCCATTTCCATCATCA
TTATCGCAGCCAGAAATCATAATGATGCCAATAAAAATAAATAATTGACA
AGTCGGCAAACTGTGCGGCGATGACACTGGCCATTTGGCTAAGCAGAAAC
GTCAAAGTGGTTAGCAGTGGGTGGTATTTACCAATGGGTGGGGCTTATAT
ATATATATATATATATATAGCATAGTCTAATGGCCAGGACTTAGCTCTCC
AGCTCTAGATGTCCTGCTCCCTGTTCCCTGCGTGTGGGTAATGGGACGCG
TCTCGCGTCCCATATCATTATGCATCATTAAGTTGATGGGCTCCCCGGCA
TCGAGACACTTCGATTTTATGGTTGTAGCATATGGATGGCGGTCCAGTCG
CTCTGCCAACTGCTCCGCCATCGCTATTAACCACATATTACTCATCGAAC
AATGTTTTTGTGGGTTCATTTGGTTTGCCCATAGTTTTATGCGCCCAACT
ATGTACAATGGACTAATATTTTGATGGGTTTTTGTATCGTTATGTGCATT
TGGAACTATGAAATTTTGTAAGTGTTCCGTTTCATCACTAAAAGATGCTC
AATCATAAAAATAAGGTACTGTTAAGATCCTTAAATTCTAAACCTATTAG
GATAGACATTCTGTCTGTGGGCATTTCATTTGAATGCCACATCTATAAAT
GTTTAAATTTAAATGCTTGCCAAAGTGAAGTTTTACCATCGATTGCATAA
CATTATTGGTCGCATTTAATGTGCCGCCAGGTCTTCCAATTAGTACGCAA
CCTTTGAGGTGAAAGTATAAGCTTCCTTCGACTGGCTGACGTAAGTCCTT
GCGTCATTGCATTAAGGATTCTCGACTGTACTCCTTGTTTGCCCTCGACG
CGCTGCTCCTTTCTGCTGTTTCTGTTTCTGTTTGCCTTGCTCTGTTTGTT
TGTTTGTTTGTTTGCTTGCCATAAGTTACCCATTGGCTGGCATCAACTTT
TGGCACATTTGTTTGACAAATTGTTTTGTTTTTTGGCCCCGTCGACGTCA
CTTGGTAATCGATACAGAAAAGGATACAGGACCCACACCTCAATTCCCCC
AATCAGTTGTCCCCAGCAACCAGTTTTCGCGAGCTTACGTTGTCAGCAAA
ATAAACATAAATATATATATATGAAGGGGTGTATAACTTATATACACATA
TACGGGCAGGGAGTGTTTTCGCCATATACAATTGACTAAAATTTCAATTT
CTTTCTCTGCTTTCTTTGCAGGTGAGTTTGCTTTCTGAGACACTTTTCCT
TTGCCTTTGCCCGGCGGGTTGTAAAATCAAAGTACGTACTTCGGCTGACA
CCTCCGCCACTCCCCCAAAAAGCACAATGGAAAAAGCGGAGAAGCCGGTG
CCTGAAATCAATAAAGTCGAACGTATCCGGCTGATAGCTGTTTAATGTTT
ACAATATGTCTTTATCTTCCCACTGCCACCCGGCGCACTTGGCCAAAACG
CTTCACCCACCAAAGCCATGACTTTGACTTTACCTTGGGCCACAAGTGCC
AAACTGGTGGCTCCTGCAGCAAATGCCATGCAAAGCGCTTCGATAATGCC
AAGCGTTATGGCCAAGTGCATCTGCATCTCCAGCTGCAGTTGTTATGATA
GCCCTGGGTGTGAACTCCTGGCAATGGAAACGCACTCCTAATGCCAAACA
ATTTAGTGCAATGTCGACGCCCCGGCAGGAAAAGGTATCCTTCGTTATCC
GATTTGCATTTAGGTGAATGCGCTCAAATGTGCAATTCAATTTGGGAAAC
TCCATCCAAACAAACAAGGCAGTACAGCCAGCGCAATACACTGCAAGAAA
GATTGTTACCTAAAGAATATAACTTAATTTACCAATCTTTTTTAACAACT
TCTTAAGTGCTTAGGTATACAGATACATCTATATCGTATCTTATAACTGA
GCTTGCCTAATGCCAACTATATACCGCTATAGAACAGAACTCTATCAATT
TTGAGATCATTTTGTTGCTGTGCTTTTGGGGGGCAAACCGAGGACACGGG
TTCGGCATGCGGCATGTTAACCAGAAAAGCAGCGCAGAAAGCAGCTTAGC
CTGCCTGTGAACCGGAGAAGACCGCTTGCCGGGGTCGACTTAGCGCATAA
AAAATTCAAAGTCAGTGAAACGCAGCTTAAGCTGTTTTTTACACAGCCAA
CAAAACACACAAAGAGGGGCGCACAAAATCGGGATAAACACACATGTACA
ACACAGATGCCGGCGGATGATGATGGGTTGCAGGTTGGGAGGGGTTGTGA
AAGTGGGATTCGGATACGTATTGGGACTGGGGGTCAAGGGTCGAGTTTTC
AGGGTTTGCAGGCTCTTCCGAGGGAAATGCCGCGGAAAAGCGAATGGCAA
AGGGATGGGAAAGAGGAGACGGAAGCTGCAGCATAAGCAAAGTAGATTAA
ACACCGCAAAGCAGTAAGCGCCCAATGAGTCGACAGTGGCTAGTGTAAAT
ACCGGCAAAAAGTTGCTTTTTGGGGGCCAAAAGCGAAGCAGGGAAGAGCA
GAGCGAAGCAAAGCCGACAAAGCGCACTTAAAAATGTCCAAAAGCGAAAC
CAGGTCGTCCTGCCGTCCAACTGATGGAATCTCTTTTTGGCCCAATCCCT
GCGGCTCACTGGGCTTAAATATTTAGCAACAGTTTGCAGTGGGGAAGTTT
TTCGGGGTACGAAGGATGGGGTGGTCCAAAAAAGTTATAGAACACATGAT
ATATGCCTGATATTTCTGGCCCTTTTGGGACGAGCCGTAATAACGTAATT
AAGTGGCTCACTTGTCGGAAGTTGGCAGTGAATGGGTTTAATTTTTTGGT
TACTACATCGAGGCGAAAGCGAGGCGAAAGTCAGCCAGTGGCAGTAATAA
TGCAATATCACAAACTTTCTAATGAGTTGTGGCAAATATTTGCAGTAAAA
AGCGGAAACTTTTGTACAGCACGAGAAACAGATTACTATTAAAATTGTTA
ACAATTTCAGTATACTGTAAACATCTTTTGAAATATTACCCAACTTTCCT
CTTCGCAAGTGTGAGAGCTCGTTGTTAAACTACCAATTATGATACGAATA
AGTTGATGTGCGTTTCATATTTATAGCACTTCACTTATCGGGTTTTTTTT
GTGATTTTGCATTTTATTGCCCTTTTGGCATACTAGAGTACTCATTACAA
TATAATAACTAATTTTATTAAAATGCAACTCGAGCAGACAAACCACAGAG
TGGAAAATGAGAATGCACACGTTAATTATGATGCTAAAGGGGCTTTAAGT
TATTTGCCAGATTGATTAAAGTTTAATTTTCAAGTTTATTGAGACGCCTG
ACTCGAGACATTTTAATTGCATGTATAGATGGCCCGAAGTTATGCAAATT
CATTTAAACATTTGCCACTGCCTGACGCACAGATTGCATATTAAATATGC
ATTAACCGCAGTTCACTTTGTGCCTTTCCCTGCTTCTTGGTAACCACCGC
ATATCCGCAGGATAACAGTATACCAGGATACTACCCACCCATGCGCCGCC
CCAATTTGTGCGCTACACTTTTCTCCGCCCGGTAATGTGTTAAATTTTCA
CAGTTGAATTTGCGTCTGTGTGTGCGCTGAGTAAATTTGAATTTGATTGA
AAAGCGTGTGACAGCGCTTCGATCCTTTTACCTGACGAAGGGTGTCGCCT
CGCCACCCGCTTTCCCGGCCAAATCCGGACCACACCCACAACCCACCCAC
ATTTGTCGAAGTTTAGATAACGTTGCGCATCATTTGGCACCCAGGCCCGA
CTGCTTACTTTGCCACGAGATGTGGTGCGCCTTCGCTTGTCAAATGGTTT
TGTATAGATTTCCCTCCATAGTTTCCCATTTCCACGGAACAACCAGCCAT
CCAGCTCATTCCCTACTCCTTCCCTCTAGTTTTTTTTTTCTACCTCGCAC
CATGCCATATAGACCATGGGTTTTTGTGACAGCTTGTTAGACGTATCCTG
GCAGTTGCTGGAAAAACCGGAACAGCAATGGCTCGAACTGAATGGAGCAT
TGTGTCCTGACGGCGATGAATGTAAGCGATTTATTTTATGATTTATTGCG
TATACTTATTGTGTATGCTGTCCAAGGATTCACTGCACCAACACATCCAT
GGAATCTGCGCCCCATTGTTAACACTTGCAAGTCGGCCGGGCTCGGCAGC
AGATCCTGTTCCGCAGGAGCAGGAGCATTTAAAAATTTTCATTCAATCAA
GTGTCAAATTAGTGGCGATTCTTAATTTAAGCAGCCATTCTACGTCGAGT
CTCGAATCTTTTCACCCTTCACCCCAGCACAGCCATCATAAATAAAACAT
TCGACTGCCACTCAATTAGAGCGTAAGTCCGGTCCCTTTTTCGGTTTCGG
AACGAGGATTCTGGTTTGGATTCAGACCCTAGTCCGAATGCCCAGCCCAG
CCAGGACCTACAAATCAAAAAATGTATAAAACATGCAATTTGTTTGCCAA
AAGTCGTGCGTAATGTGGTCCCATCCCGGGTCCTTTCTTGGTTTCCCAGG
ATGCGGACTTGGTCCTTCCACTTCAAAATGAATCCGTTCCTGTTAGTTGT
TGGTGTTAGTGTTTTTGTTACCTAAGCCCCGGCAAAAAGTTGGCAAATGA
AGTGGCAAAAGTTGCTTGTCTAGACAAAAAGTGAAACCGATGCAAAGTTA
GCAGCATTTTGTCTTGCTTTGACTCACTCAACCTGGGTGTGATGTTATTT
CGATATGGTATCCATCACAACCTCCTTGAGTGAGCGATAGCAGGACAGAG
TATCCACGAAACTAACTGGCACCAGTGAAATACATGTAATAAAAATATTA
ACAATTGTATGTGTGTAATTAAAAATCACGAATTTATATTAGAATTAGGA
GCCTTATTCACTTTTACTGATGCATTTCTATATCTTGTGCTTGTCAATTA
ACTTAAGTAAGTAAACATCGAATGAAATGCCAGCAAGATAATTATAAAAT
AAAATAATTACTTAAAAAGCCTCTTTTGTTTTCCTGACTATTTATATTTG
CTTAAAGTAATCAAATCAAATGTGAATTGAAAACAAACGATTCAGGACTT
AAACCATCAGGAATTTAGAGGCCGCGGGCGAAATTCGAAGGCATGTCGAC
TTAATAATGCTTAATGGCAAGAATCATTTCGGGCAATAAATTCATAAGTG
CATATGGCACACTCGCAGCAAAAGAAAGCCATTTGATACAGCCAGCTACC
GTAACTTGGAGGCTCCTCCTGCCCGCCACTCCAGGATGTCGTTCCCCGGG
GGCATGGTATGGGAATGGGAATGGGAATGGGTATGGGGTATGGGTATGGA
TGGCATGGCATATTCCGGGCAGCTTCTTGTGGCAAATATTTACCTTTTGG
GGCCTTTGGCATCCCGCATGTGTCGGTCGTCTGTCTGATGCTGGTGTGCT
CTCTATGAGAAAATAACATTTGCAATTTTAAGCACTTGAGACTTGTCACT
GGGAGCTGGCTCGGATATCAGTATATGTAGCAGTATCAGCAAGGATATAC
CCCTGTCAATATCTCGCATCTCTGGCTAATGGCAAATTTGCAGTTATTAC
TCTCTCGTACTTTTTCGTTATTACTCTTGTGGCCAAATTGTGATTATTTA
TTAATTAAATTTGTTATGACAACACAAGTTGCAAAGTCATTTGTTTGCCT
CGCTGCGTGTGGCTTTCCGTGGCTTTCGGCCAAAAGCAAGGGAAAACCAC
GTAAAATACAAGCGGCCAGTTTGTGTATAGCCCGTTCGGGCTATTATTTC
AAGACTCACCCGGCTGGCTGGTTGTCCTGCTCTTAAGCTATTTTATTGAG
TTTTCCACTCCCAACCGTCCCTTATCAAACCCTTTTTGGCCCACGCACAC
ACACACACACACACACATCGCACAACAAATCGCATAATTATGTTTGTCGA
TGGGGCGGAGTTCAGATTTTCGACCCCGAGCAGGTGCACAAAGGTAAAAT
AATACAGTGCGCCAGGCATTTTAAGCTGGCTTAAAGACCTCGGCAAAGTT
TATCCGCTGGCTTTAAATTAACCCCGATACGGTGGCTCTTTGGCCATAAT
ATCCAGAGTAAACCAACTTGAGCTCGACACTTATGAGACATGTTCCTGCC
ACTTTGCACTTCGGCGCAAATTTTTGGCCGCCAGCACTTTTCACTTTTCC
TCTCATGTCGAAGTGCGTCCAGCTGAGCAACAAGAGTTATGTAATTGACT
CGAAATACCCTCGGAATATTTGAAATTTTAAGCAGCAGCAGCAGCAAAGT
TTCGCCTGACGACAGGGAAAAATTGCCGAAAAAGAAAGATTTCTCATTTT
CCAAGCGTTTTAATTTGTGCGAAATTAAGCAAAAAATAAACTCATTTTGC
TAGCTGCAGCAGCAGTAGCAGCACAAACATGGCGAAACTTTTTCGATAGC
TGTCTGACAACAAAGCGAAAATCTAAAAAAAAAAAAAATACAAGTAAAAA
GCTGGAAAAACTTTCAGCGGAAGTTGATGGCAGGAAAACTCAAGTAAAAT
GTGCACGAAATTGTCTCTGCGCGAAAGAAAAATCTATGCGATTGAGGAGA
AATTGCTAAATTCAATGCCCGCAGTAGTCTGAGCCTCCGGCCTTTTCCAT
TACGGCATCTTCATTCCGGCTATGGCTACGGGCACATACCACTCCCCCCG
CCCCCGCCACCTGACCGCCTCCGCATTTTGGCCGTGACTTAGTGCCGACT
TCATGCAAAGCTCTTTCCATCCCCGCCGATGCCGCTGCCGCCGACGGTGA
TTTAGTTGTTAGCCTGCGGACAAACATTTCATGGCTCGATGTGCTCAATT
CAATCAATTGCCATCGACAGACGGCAGTCTGCAAGGAAACCACCACAAGG
ATACGACTATCATCCTATCGACCGCCAAGCCGGTGCAATTTTAATCAAAA
TTCGCATGTATGTGCGCCAACTGATGTATGGCGGATCGGTTGGCTTCAGT
TGTCACAGGTTGGCGTAATGGCGACATCGCACAGGATGAGCAAGGATATC
GGGGATTTGCGTGCGGCTCAAGCCTTTGTTAGCCCACTTGATATTCGGCA
ACGTGGTGCATTAAAACTATTCTTAAATCGGCGAAATCAACTTACCATCA
GCCCAAGACATTCACATTTAATAAATATATATATATATATTGATTTTTAA
TATTTGGTGTCGTTTAAATCTTCGCAATCAAGTCTTTAGATCCCCAAAAC
ACTAAGACGCAAAGTCAAATTCTCCTGAATTGTAATAATATACTCCTGGT
ATTATATTTCATAAGTAAATATTTGAAACGAAAATGTATTTATTTTACCT
ACATATGAGTAGGTGTATATGGTTAGTTGTTATTTTTTTTATAGTTTGAT
CTCATTCAATCTTTTCACACATGTGCTGTTGCTTCAAATCTTTGAACGCG
GATTCTTTCAAATCAGTTGGACCTTTGAGTATATTTTTGTAAGCGCGTAA
TAGATCTAGAAAATTAACTGGTTGTTCCGCCCACTTGTTTTTCATATCCT
CGGCCCAGTTGGCTTTCAACTCGTCCTTAGAAGTAACCACATTCAGTAAA
AGATCTGGGAGAACTATCGATTTTTCACGAGCCGCGAACAAAAAGCCTCT
GAAGTTTTCGATTTTTTCTTAAAGAAGTGATGTGATCTCCTTGGTCTAAA
TAGTATTTCAGAAAGTTCACATATTCTTCCCTATCTTGGTCGTCCTTTGT
AATTTTAATCTCCTGCTCCAGAGAAGATTTCAAAACATTCACATGCATTT
CAATCAAGTTGTGTCGGTATGTATCGACATCATTAAAAAACTCGCAGAGG
GTATCATTTTTTTCATTCAAGGGAGACCTTTGGAAAGTGCATTAAAAATA
AAAAAAATGTATTAATTTTTTTTAGAAAATGCTGACCAAAAAGTAATGAA
CAGAATTGATAGCATTCTGCTATAATTTGTTTAGAAATGTGAGGTTCTTT
AAGTTACAACGCCTTATATAGAACCTGATTTCTTTACTATCGCGAATTTC
TATTAATACCTTGGTTCAATGACGTCGAAATGGACGTCAATCTTTGTGAT
GCAACCATAAGAAAGCATTTATCGTATGATTGTATTATATATGAAATTTG
CAAAAGGCATAATTTCTCTCACTTTTTTTTAGCCTTACATTTCTCGGTTT
TTTCTAATTTAGTCAGCTCTCATGTTTAACTTTAAGCAATTGTAGAACTT
TGTTGGAAAAGCATTCGACTGTTGGTCATCACGAGAGTAGTGAGGACTAT
TTGTCAGTGCAAAGGACTCGCAGGCAACGCAGCCCAGCGATTTCCTTTTG
TTATTCACAGGCCATAGAGAGTGGGCTCCATCCATTTGGCTAATTGTTCA
GTTTGTTTTACGTGTAAGGCTACAAATTGGCCGAAGCACACGTTTCCCCA
GACAGCTAGGTAGTGCCCGTTGTAAGAGACCGAATGCACGTTCCGCTTTT
CCGGGCCGCCACCCACCCATCCACCCACCCACCGAAATAGCCAGGAAAAG
GTCCTGCCGCCTGTCGGGTTCATAATAATTTAAATGCTGGGCACACAGAG
TGACATGGTAAAGACAAACAGAGGTCAAGCTGCGTCAGTGGCGCTGTTGC
AGCAGAAGCAACTGCAAATGGCTACGTGACCGGATGCAGTGCAGCGGTTT
GCATTTAAATCCAAAGGCGGCATCATCAGAATTAGCACGACAAAGGGTTG
CCAGTCGGAGTGTCCTAACAACCGGGGGATTTAACATTCCGGAGTGAACG
GCAACCGGCTTGAGTTAATTTGCCCTGGCAAGCAACAAGCTCTGCGCAAA
TACCAAACGACAAACGGTCCACAGTTCTGCCACCATGGCCATCATGCCCA
CCCAGTGCAAGCCCCATGCCAAGACCAAATCTGAATCCGAGTCCGAAAGG
CTTGGGCCTTTCAGATCAACAGCCGAGCAAACAAATGGCGTTGCAATTGA
GCACGTTTTTGTCGAGCAATGGAAATGAACTGCGACACGGTGATTCAGTT
TGGCCAGCGCCAGGAGTCCAAATGGAAGTCGGAGTCAAAGTTCGGGGCTA
AGTTCTAGCCCGTCCATTCTGCCCAGTTCATGTGGCAGGTCAAGTGGCAT
GCGGCAGCTGACAGGACGTGCGCCCAGTTGATGTTTTCACAGGATATATA
TGTGTACCACCGAGTGAGCACACTGCTGCGGGATGAGTGGATGCCGAACT
GCGCTGATTCCTTGTGCGCATTCCGACGGAAAATCAAAAGCCATTAGGAA
AATCTATAAGAAAATTGCACTTACAGCAGCTCTGGACATATATTACACAA
AACACAAATCAATACTAATTCAAAATCAAATGGTTTCCAAGCATAAGACA
AAAAAATGTGGGCCTTTTTTTGAGCTTCCCGTTCTGTAATCAGTATGAAA
TAGCCCATATTCGAAGCCAGACAATCTACATGTCGTGGCTTAATGGATCG
AAAAATTGTAATTGGAAACGCTACGATTCCGTAGGAACAATGGAAAACTG
CTGTTCCTTTTAAGTGGGGCGATCACTGCGTCTGCAAGTGGCTAGATGCC
TAAATGCATATTGAGGAACAGCACGCACCTAGAGAATCCTGGCCAAAAGA
CAATGGCTGAAAGTCAAACTAGGCAAGGGAATAAAAAGCGCCGGCAAATT
GGTATGGAGAAAGCATACGGCAGAGAGGCAAACAAGGTCCTGGGTAAACC
GCAAAAAGGATCAACTTTCGGCCCCTATTTTTTCTGCGTTAGTTAACAGC
AGCAGGAGCAGCCACAGACTGGGTCCGGCATAAAAGAAACATAACTAATT
TGCATAAAATGCGGAAACACGGCAGCAGCACACAGATATCTCAGTTTGTC
CGGAGCGGCGGGAGTGGAAATACGGAAACTTTGTTGACGGAAATGGGGCA
AAGTCGCCAGTGGAGAGTTGACGCCAAAAGGCAAACCCGCTGCGGTTTGA
GCCAGGTTTTGGTACTTCTCAGGTACTATGTGTGTTTGCCCGACTCTTTT
AGACAGAGTTCACAAAATACTAAACTAAGTGCAGGCCACCAAACTCCGAC
CCGCCGCCCATGTATTTAAGTGAGCGAAACTTTAGCATGACAAAGTGAAA
GTGGAGTGTGTGGGCGGGTGAAAGTTGGCACTGGCCACCATATTAGCGGT
TTGCAAAATATTCCAAGATAAGACGGAGACTCGGTGCCTACAAGGCGTGC
ACGGAAAGAAAATTTGTTTATATCCATAGTAGGACAATCCTAACTTGTTT
GAAGGTTTTGTAAAGGTTAAGTTGGGACTTTGGTTTACTTATTATAATTT
CCATCAGGTATAATTATGCCAAGCATTCAATGCTGCCACAAATATATAAC
TATAAATATAAATATAAATATCCATGATATATATACCATATCACTTTATT
CTCTTTGTGTGTATTATGCAAAGGATGAAACCCTTACAAAGTGGAATATC
TTAGCATGCTGATATCATGTTTCTTCCTTCGTCTTTCCTTGCAGCATGGT
CAACAGGTCGATGCCCGATGCCTCCAAAGTCGAGAGAATGGTGCAGACCG
CCCTGGACGTTTGGGCGAACCACTCGAAGCTGACATTCCGCGAGGTCTAC
AGCGACCAGGCCGACATTCAGATACTCTTTGCGCGGTAAGTACTCCGAAA
TCTATGGGGATTGCGAATCGGGCGATTGGGGATGCATGGATACGAGCACT
GGTGGTAGGTGGTGGGGAAGATCATAAAAAAGCGAGTCTTTAGTGCCATA
AACAAACGCACATAAAATTGCACTTAAAAGCAGGCGAACGATAAATAAGC
CAAGTATTAAATCCATGGCCATCCAACGACGTCGATGATGAAATGCCACC
GATGACAAAGTCGATGGCCATGGCTGCCGTGTCTGAATCAAAGAGTTTAT
GTGGCAGCTGCTTGTTCTTAGATAAGCTGTGAATATGATTTCCCCCTTGG
CCATGCTCGTAATTCCACTGGAACACCGAACTAATCCAGGACATCTACGC
TGGTCCTTTTCTCTTCACTTTGCAGGCGCGCGCACGGAGATGGCTATAAA
TTCGATGGACCTGGTCAGGTGCTGGCCCACGCCTTCTATCCCGGCGAGGG
GCGTGGCGGAGATGCCCATTTCGATGCGGACGAGACGTGGAACTTTGACG
GCGAATCCGATGATAGCCATGGTGGGTGCAGTTCATCAAGTCCGTTGGCC
AGGCCACATAATAATGCTCTTCTTTTGACGTTAACTAATTGCATTAGAGG
GCAATAGTGTTTTGGCGGCGCTGTCTGGTCTGCGGTTTTTTTGGGTTTGC
ACTGGGAAAAATTCGATTATATTTAAATCGTTAGTTTATTAATGAAGTTG
TGTAATAACGCAAAATTGACCGCTATATGTTTGCTAAGTGTGGGGCGTTT
ATTACACATTTTCAATAGTAATTTGTTTGACAAACGCAACTTATTGCTAT
CTATTTGATTATTCATTTAAATAATTGTAGTGTGTATGGCAAAATAATGA
AGATTTTTTGTCACGAATGACTTCCACATTTTCGTTAAGTGCAGGGCGTG
ATACGTACTTTTATGAATATCATTTGAAATTGCCATTTATTTTTATTAAT
TCGAAAACTTATTGTTAGTATTATTAAATAGCAGTAAAGCACGATGTGCA
GGGGATGCTGACTAATTAGGTTGTACAATGCATTTGTTGTCATAATCGAC
ATATGTTTTTCGCCAAGTGCAGGGCGTGTTACACCGAAACCACATGCGGG
CAAAATCAATAAAGGCTGCATACGCTGCTGCGGTAGGGAATTGGGAATAG
GTCGGGAAGTTGGCCCACACTGATGGCGAAGGGGGTAGTGGAAGAGCAGA
CCATGACTGGCGACGCGTTGCCTGCAGCCTGCCGGTTGCGTTTTGTAATT
TAGCACAATAAATCGTCAGGACATACCCCAAAGACCCCGTATAACCCGTA
GACCCCTGAAACCGAAACCCCACGGACCCCGAATTGCGCTTCGGCATTTT
TAATGGTTTTTAATGCCAATAAAAAATTGTCAGCATGACGCGTGACGTTG
GCAGCCATTTTAAAATGTTGCAAGCGTCGCCATTTTTATGCCACTTACAA
AGTCGTCAAGGCGACGAGCCCGTCTTAAACCCCATCCTGCAGCCATCCTG
CCCCCTTCCCACCCCTGTTTGGCCCTTTTTTCTACCGCCATTAACCAGTC
AGCGTATTTATGTTGCATTCCGTGTCCTGTCGTTGCAGGAACCAATTTTC
TGAACGTGGCCCTGCACGAACTGGGTCATTCGCTGGGACTGGCCCACTCC
GCGATCCCGGATGCGGTCATGTTTCCATGGTACCAGAATAACGAGGTGGC
GGGCAACCTGCCCGACGACGATCGCTATGGCATTCAGCAGTTGTACGGCA
CTAAGGAGAAGACCTGGGGGCCATACAAACCACAAACCACAACAACGACA
ACAACCACGACGACCATGCGCGCGATGATTTACCGGGCAGATAAACCGGC
CTACTGGCCATGGAACAATCCAAGCAACAATCCCAACAATGATCGAAATC
GTGCCAGGGAGCGCCAGGAGGAGGAGCGGCGGCGCCAGGAGAAGGAGCGG
CGGCGCCAGGAGGAGGAGCGGCGGCACCAGGAGGAGGAGCGGCGGCGCCA
GGTGGAGGAGCGGCAGCGCCAGGAAGAGGAGCGTTGGCGTCAGGAGCAGG
AACGACAAGAGGAGGAGAATCGTCGGCGCAAAATAGAGCATAAAAGCCAG
TGGGAGAGGAATCCTAGCAAGGAACGGAATCGTCCCAGGGAGCGCCAGGA
GATGGAGAGGAGGCGTCAGGAGCAGGAGCGACAAGAGCAGGAGCGACAGG
AGCAGGAGGATCGTCGGCGCGAAAGAGAACGTGATCGGCAGTTGGAGTGG
GAACGTAGGAATAGGAATGGAGCCCGGGAACCAGTCACTCCCACGGCCAA
TACCACCCCGAGACCAACCAACAAGCCATATCCCACGGTTCACCGGCAGC
ACCACCACCATAACAAGCCGCGGAAACCCAAGCCGGACTCATGTATGACC
TACTACGATGCCATCTCGATTATCCGCGGTGAACTGTTCATCTTTCGGGG
ACCGGTAAGCTTTTCAACTAGGAACCCATGTACATTACCCACGATTACCT
ATTAATCTTGTTCGACAGTACTTGTGGCGCATTGGAACTTCTGGTCTGTA
TAATGGCTATCCCACGGAGATCAGGAGACATTGGTCCGCTCTGCCCGAAA
ATCTCACCAAGGTGGATGCTGTATACGAAAACAAGCAGCGACAAATTGTG
TTCTTCATAGGTGAGTTAGAGATTATGGTCTAGAGATTCGATGATAAACA
ACCTTCATTCTGTCATTTTTGTGCCCCAGGTCGCGAGTATTATGTATTCA
ACTCGGTGATGCTAGCTCCTGGCTTCCCGAAACCACTTGCCAGTCTGGGT
CTGCCGCCCACTTTGACCCACATCGATGCCTCCTTCGTGTGGGGCCACAA
CAACCGCACCTACATGACCAGCGGCACACTGTACTGGCGCATCGACGACT
ACACGGGTCAGGTGGAATTGGATTACCCGCGCGACATGAGCATCTGGTCG
GGAGTGGGCTACAATATAGATGCGGCATTCCAGTACTTGGATGGCAAGAC
GTACTTCTTTAAGAACCTGGGATACTGGGAGTTCAACGACGACCGCATGA
AGGTGGCCCATGCCAGGGCTAAGCTCTCGGCACGAAGGTGGATGCAGTGC
GCCCGCAGTGCTAATGAGGTGGACGACGAGCAGCGCTGGACGGCGTCCTT
GGTATCCGAGGGCGAGGAAACGGGGAGAAGCGGCTCTAGGGAGCTAAGGA
TCAACCACTTCATTCTTTCGATCCTTTTGCTAGCCATCGCCAACTGGCGG
AGTTAAGATTGAATGTGGAGCGTAGCCTAAGAAATGTCTAAAACTAAGAG
AGATGGTTTTTGTAACCAAAAATGAAAGAAGCATATTGGTCTGTTATGAT
CCAATTCTTCAAGGAGCTTTGCGAAGTAAAAACCGGTAGATCTAGTATTC
AACTACTCAAAAACTGCAAAGTTGCAAATTACTTAGGTACAAGAAGGGAA
ACTTAAATGTAAGCTTGGCCAATTTTAAATTGGAAATCAAAAAGTGTTTA
AGATTGAGTTGTAAATTGTAGCGGCCTGAGCAGATTTAATGCATTTTTAA
CTGCAGAGCGCAGCTGTGTGACAGTCTGGCGCTTCAATGCCCCCAAAGAC
GACACCGAGCGGCCTTTCCTTAGATTTAAGGAAAATAAATCAACACACCA
GTGAAAGTCGCACATAGATGACAAATCTGCGACTTCAAACTGACCGATTT
ATTCATGGACACTTGCCAATTGGGCACACTTGCGCCATCTATTGGACAAA
TAGCAGGGCTGTTTTACCAGATCTATATACATATACATATACCGTACATA
TAGGATAAGTGCACAAGACTATAAGGTAACTCGTAGTCTACTTAAACGTA
GAAACAAATATGTTCTATTTGTACACAGAAAGTATCGAAATTCCAATGTT
GAAATTCGAGACCACTACTGCCTTATGAATAAGTAATAGCTATGCCTTTT
ATTGAAGAAAGTTGGACCGTATGGTCCGCTTTACTTGTTTCCACGAACCT
TTCTAATTATTTATATATATATATATATATGTGATATTATAATAAATTCT
GAGCGATTGTAAACAAAAGATAAACTGAACAAAAAACTATAACCTTACAT
TTTGGTTAGTTTTTAGTTCAATTTAAACAAGATACTTAAGCTGCAAAATA
TCATTTTCTACACGATTTTACCCAAAACAGAACTATATAAATAAAGAAAT
ATATAATGCAAAATTCCGTCATTTATCACTGGTTTTACGTTATTACTTCG
TTTGTTACTAGCTTGTCTGTCATGTAGGTGACATAAAAAATAACTTTTCT
ACGGATTGTAGGGTTTGTAAAAAAAAACTCGAAACGTACATACGCTTGTA
GACTGGGAAACCGACCCAATATAACGGCCCTGATGGGCACAAAAATTTGA
TATAGCCATGATGACGGAGCTAAAAACCCAAAATGGGAGCTCACTCCGAT
ACAATATTATCGTATACGTATAATCGTATCACTGAAATAAACAAATGCAT
CATTAGCGATAATATCGTTATCTCCAAGTATAGACAAGACTGAGGTATAT
CTGAAAAGTTAGTTATGACGGTTGCCATCTGAAAATATTTACCGCTCTGC
AGGATCAGCAATATGTATGTACATATATGGTGTATTTATAAAGCATGTTC
GCTTGAATGGAGTCTTCCTGTCGGCTCATCTTTGAGTGCCACCGCTATCT
GAAGCACTATAGATCCGCGGCGATCATAATGGTATTGTAATGATAACTCC
GCTGTTAATGGCCTCCGATGACCTTATCTTATCGCCCGGAATTAGCTGCC
GTTTGACACAAGGTGTTAATTTAGTGTAACAGTCACCAGCTGTTCGGGTC
GGGTAATGGCAACCACATGCGAGATCTATCGTTGGGTTCTACCGGCGTAT
GAATATATCGCTCCCGCTGCTCCGACGACTGTCATTTGGCTATGCGTCAC
CTCGCCTCGCAGCCGTGACGTCCACACAGTTCCACAGTCCCACCGTTCGC
CATGTAGTCCCGTAGTACCCAGAAACATACCCAAAGTTGGCGATTCCACG
GCGACTCGGTGACAGTTGCGCGCCCACAGTCAAGCCCAGCGGTACAGCAC
TCAATTTTGGCGAGGAGGCGGCACTTATCAAGTATACTATATCTATTATA
TACATTCATATATGCATATATGCATATAGGCCAGCTCGTATTAAATTAAA
GACAATTGGTGAGTAGAGGTCGCGACAAAGCGAAGATAGACCCGAACGTT
TGCTTTTGATCCCGGTGCAAGACAACCTGATATTTGGGTTTACGGGCACT
TGGTGAGCACTGATTAGTGATCCCTACCGATAACGGGTATCTTTTGTTGC
CCAGCGGGCGGTGTGTTTTTGATTTCGGATAGGGCGTGAGCGCCCATACT
AATTACCATGTAATTTATACGGCAGTAAAAAATACGGACTATTGTGTTCT
TATCCTAGTTTGCTTGTTTGTTTCAACACTTATGGCTTAGATTAGCCGAG
TATTACACAAATATTTTGATTGTGCTTAAACAGTTAATACATTAATTAGA
CAGGCCAAGCAGTCGATATTGTTATTTTGCCTTATTATTATTGACTTAGC
ATCGCTATTAATGCTCATGGCATGTACTTATGGTTTTAAGACTGTGACAC
ACTGCAAATTCCACAGAGATTTAGATCTCTACTTAAGTAGCAGCTATTTT
AATCTAATCGAAAACATAGCCAAGACTATGTCGAACTTCAGTGACGAAGA
AATGGTGGCCATATGGCATGGCTACTATCTAATCATCGCTCAAGAGACAC
CAGTTACTGTCATAACTAGGCGGAAATCGGGGCCAAAAGCAACCGGTTGA
CTAATCGCACCTGGAAAAATTTCAATAAATCAAACCTATGCTTTGCATCG
AACAGGTGGTGATAAGGCAAACCCAGCGAAAAGTAGCAATGTCGGAGGCC
TATTCGAATTCCATACGCAGCCTGAGTCCAGAGCTGGCCAAAAAGGCGCA
CGACGAGCTGGGAGAGATACCCGACAGAATCGATGAGGATATCGAAACGT
TGCGCACTTGGATCTCCAAGCAACCTCATCTCAAGGCTCGCCAGGATGCC
CAGTTCCTGGTCGCCTTCCTGCGTGGCTGCAAATACAGCTTGGAGAAAAC
CAAACTCAAGTTGGACAACTTCTATGCGATGAGGGGAGCCGTGCCCGAGC
TCTACAAGAATCGCATTGTGGGTGAGAAGCAGCTCAGCATTCTGGACACA
GGGTGAGATCTACTTGAGGTTGTAAAAAGAATGTTTCCTCATAATTTATT
CAAATTGCAGTTGCCTCCTCCGATTGCCGCAGCCACTGCAGGCTGATGGT
CCTCGCATCCACATCTCCCGCTACGGTCAATACGACTCGAAGAAGTACTC
CATTGCCGAGGTTGTCCAGGTAAACACGATGCTCGGCGAGATTCAGATAA
GGGAAGACGACAATGCTATGATATCCGGCTTTGTGGAGATCATCGACATG
AAGGGCGTTGGGGCAGGTCACCTATTCCAGTTCGACGCGGTGCTGGTCAA
GAAACTGGCCGTTTTGGGCGACAAAGCGTATCCCTACAGGCCCAAGGGTT
TTCACTTTGTAAATGCGCCCTCCAGTGCAGAGAAGTTCATGTCCATTGCC
AAGAGCCTGATGAGCGAAAAGATTCGGAAACGGGTGAGTTTATCAAACAT
GTCACAAAAGTGTAACCACTATGGAACATTTTCTACCCGTCTAGTTTCAT
ATACACTCCAAACTGGACAGTCTCTACAAGTATGTGCCCAAGGAATGCTT
GCCAGCTGAGTATGGGGGCAGCAATGGAACCATCCAGGACGTCGTCAGTA
CATGGAGGACCAAGCTCCTGGCCTACAAGCCATTCTTTGAGGAGGAGGCT
TCTTATGGCACGAATGAAAAGCTACGGCGAGGACAGCCCGTTAGCGCCGA
ATCACTTTTTGGAATCGAAGGATCCTTCAGAAAACTAGACATCGACTAGT
CTAGTGCGTAACATATAAAACGTAGTGATTTTTAATCTTTGTACGAACAC
AAACAAATCAAAACTAAACAACATAAAACTATACGAATTTGGTTAAATAG
TAAGTGGTAAGTACTTGAGTCCTTACAACTTTGCCGCCGTCGATTGCTTA
GATTTTCGGTCAATAAAAGTCAGTCCCTCGTCATGGTAGGGATTTGCGGA
TACCCTTACGCGTTCCAACCATTTGACCACCTTTGGGAACTTTTTCTCGT
CCACTCTGTATTGGCAGAGCCCTTAAATACAATAAAAATAATTAGTTTCG
TTAAGTTATCTCCACACTAGTTTAACACACTCAGCTGGTTGATTTCGGAA
GAGCCAAGGATATCAGCCATTGTCAGGTTTTTCCCAACCAAAAAATCATT
TTCCAGCCACAGGCGCTCCAGTAAACCCAGATTGTTTTCCACTCCCTCAA
TCAGTGCTTGAATCTGCTCTGGCTTGGGCTTGGGCGCTATCCCGTTCATG
GGAAACAGCCAGGCATCTCGAAAGTACATGGAACATGCAAGACGAATGTT
CAGGTGTTGCCACTCAAGGAACTCATCCACTCGGGCACGGTTCTCCAGCG
TCTTTGGGTAGAGCTTCTCATCGAACTGACCTTTGTCTGCGAGATATCTG
CAAGGGGGCAATGTACGATCCAAATGTGAGATTGCTTTCCAATGATGGCC
TTCCCATACCTTATAATCGCTATGGTCTCAGACAAATGGAAGTCCCCACC
CACAATGGCGGGCACCTTCTGGAATCGATTGATCTTCTTGTACTCGTCGG
TCAATTGCTCAACTAATAAAACATAAATGAGTCGGGGCAGTTTAGATGAT
TACTTTGACTCACATTTTCGCAGGGCAATCGGGCAATACTCAACGGGTGA
GTTGCTGAATTTTAAACCAATCCATAGACCACGGGCGATCGGGGACAACA
AATCGTAATAGAATCTAATTGGCTTGGACATGGTGGTCAATTGCTCCCGT
TCCTCAGCCCCAACTTCCAAACAGCCGGCAAAAACGAATATCTTCAGCTG
GAAAATGAGAAATTGAGCAAAGCTCCAGTCAAAAGATCTTGAGTGTCACC
TTGCAACACTGGTTTTATGCTATTATAGTTGTCCCGCTTTAGGAGGCAAA
TTCAAAAGTGGCTCCCAACTTCAAAGATAGTTATATTATATAAAGCGAAC
ATATGAAACTATTATTGATCCGATATCACCCCTTTTCATAGTCTCTAATT
ATTTTAACATTTAGGAGTTTTGCAGCGCAGAACTGAACACAATAAACATC
AGATAAGGCACAAAAATGTTTTAAAATCCTAATAAATGCAATGAACAAAG
AAATCAGTCAAAATCGAAAAGAAATCAGTTTTTGGCCTTGACTGCCTGCT
GAGAGGTCTTGTAGACGAAGCTGTGGGCCTCATCGTAGTAGGGATTGGTA
GCATCACGAACGCGTTCCATCCACTTGGCCACCTTGGGGAATTGCTTCTC
ATTTACGTTGTACTGGCAGAGCTCTAAATTACAAATCGTTATTATTAGAA
TTTATTTTAGATACAGCAGTGGGCTCAGTCTTACTCATCTGATTAATTTC
TGAAGACCCGAAGATGTCTGCCACGGTAAGTTTGTCGCCGACTAAGAAGT
CCTTTTCCAGCCAGAGGCGTTCCAGTAGACCCAAATTACTCTCCACATCC
TTGATTAGCTTCTTGACAGACTCTGGCTTGGGAGCCGGCGCCAGTCCCTT
TGCCGGAAGAAGCCACACCTGACGGAAGAACAGGGAGCAGACCAAGCGGA
CATTGAAATGCTGCCACTCGAGGAACTCGTCCACCCGCGCGCGTTCCTCC
AAGGTTTTGGGGTACAGCTGTTCACTGAAGACTCCCTTGTCCGCGAGATA
TCTGAAATGTGTCATTTATCTATAGTATTAACCTGGCAATCCGAGCTCTG
GATACTTGAACTTACCGCACTATGGAGACACTCTCGCCCAACTGAAATTT
ACCATCCACGATGGCCGGCACCTTTTGGAACCGATTTATACTGCGATATT
CGTCGGTCAATTGCTCCTCTGGAATATAACCATCCCAAATGTTAGAAGAT
CTTTATACCTTATATACATGTGTAACTTGTTATTTATTCTTACGTTTTCG
CAGGGCAACCGGGCAGTCTTCAAATGGGGTCTTGCCCAATTTCATAGCAA
TCCAGAGGGCGCGGGATGGCTGCGATAGGAAATCGTAATAATACTTAATA
GCCTTCGACATCTTGGCAATTAATTAATCAGTTAGCTTCAGGAAGCCCGG
TAAACACGAAAACAAAATATATTTGTTGTCGCTGATGAAATGTCAAAAAG
CTCAAAGCAAAAAGCTTTATTCCGGTCCAAAGTTCAAACTGGTCGCTTTT
CAACACTGTACCCAAAATGATATTGCCATCCCATCCCATTCTATGGGGAA
TCCGAGAAGGGCGGGCAAATATATAAGTTCAAAATAATCAGGTGGTGGTA
AGAAGTCAGATAAAATATACCAATGATCAATAAAATTAAATGCTGTAGCC
TTGCTTTTGTCATAACCGAAAGCTTATCGATTTCACTTATCGGAATCTCA
GTTCAAACAGCGATATGTCAACCAGTCATCAAGAACCACAAAGCGTTTAT
CTCGACCAGATAAACACATTACCCTTACCCCATTTATGAAGAAGGCAACC
CCAAGTAATACCATTTATGTTTTAGTTATACCGACATTTAAACAAATTCG
CTTTAATTTATTAACGCACTCAACATGGGGTCTACAGTACATTGTCACAT
TTAAATATAGTCATTTAACTATGTATGTATTATCCATAAATATAGAGATG
CATGTATATGTATGTGTAAACTAGTATCAAAAATTAGTAAAAACGACACT
TAACCAACTGAAAAATTATCCAAAATATATATGTATGCTCATGTACCGTA
TTTATAAAAGTATGCGATAAAATCAAAGCCAACAACAACTTAGCACGCAA
GTAGAAGACGTTGAAGATTTCATCATGAAAATGCATTATGGGATCATGGT
AGAATGAATCGTTCGACCGGACGTTAGAATGTGTATAAGTATGTGCGTGG
ATAAGGACAGCAATAAATTAAAATCGACAAACTTGTGAGGTTTTTGTGCC
ATTTGATGGCGATCCATTTGCTTCTTATTTCGTTTTAGTGTGCACTTGTC
GTCTATAATATTGTTCAATTTGCTTTTAGTTTCGATGTTCCTCCCTTATG
GTTTCATTTATAAAATATCAGGTTCTGCTATGACCAAAGATCGCTTTAGC
GCTGTAGTGTCTATACATTCCAGTGTGTATATATCGGGCTGTGTGTTAAA
TGGGTGTTCTATAGGATGTGCATCAGAATATACAACTAACTGCCCGATCA
TTGACTCAATCGAAGTTAATCATTCGGAAGGTTCCGTCGTTCGGAACGTC
GGTTACTAACGGAGCACCCCTTTCCTGATCCTTCTCACTGGCTTCCCGCA
ATTTCTCATCCACGCCATATCGCTCGTCTTCCGTGAAGTACGGGGAAAAG
CTTAGCAGCTGGGTCTCGTAGCGCGTCATTGCATCAGACAAAGATCCATT
ATCGCCGCCCATTTCCACGGGTAAATACTCCAATCCAATTGCCTTTCGCA
GAGACGCGACGGTGGAGTGAATGTGCAACTGTAGGAAGGGTAGCAAAGAG
TTAGTGGTTCTGCATCGATTTTCCCTTTGAACTCACCAGCTCCTTTTGCT
TCATGACATTCCGAACCAGTCCAAGGACAAACTGCGTCTCCCTGGATGCA
TTGACAATGTGCGTGGCCACTAAATTCGCTGGAATTCCATGCTCTAGGAA
TGCATTCATCCGCTTGAACATGCCAGGATCGAACTGCAGTAGCAGAGAGT
AGGGTATCTTGGTGAAGTCGATGATCTCCACCACGCCGGCTATGTTCCAG
TTGTCGTCCGTGTTGATCTCGATCTCAGCGCGAAAAGCGTGGAAGCGGAA
AATGTCGCTGACACTGTGCTTGGAAGGTTCAATGTGACCCATTCGTGTGT
AGTGGATGCGGGGGCCACCAGGGCCAATAGGTTTGGGCAATGTGGCGAAT
ATTCTGCAAAAGAACAAGTTTTTCTATAACACCCACCTCCAGAAAATGAG
GGGGGTCCCCGCCTTACCCTGAACGAGCCAGTTCTATCAGCTTATCGTCC
ACCTGGCGACCCTTGAGCAGTTCTCTTTCCTTTGATTTGTAGGTGTAGTA
GAAGAGTACCCTCTTCTTGGCCTCCTCTACGTCCCAGCGGCAGAAGCGCA
GAAAGGCCACCAAGAACTGATCGTCGGTCCGCGCCTCCAGGTAGATCTGT
TTGTCGATCCAGGTCCTTAGCGCCTCGATCTTCGCAACCGTCGAGGACGG
ATCCTCGCAGAGCTGCGTTCGAGCCACCTCTGCCAGCTCCGGCTCCAGCG
ATCGTATCTTGGCCATGGTCACAGGGAATCTGCAAATCGATCGATACTTG
TCTTAATTTTGAGATACGATACCGAAGGCTTGGAGTGTGCTAAGGTGTGT
GTGTTCTCTCGCCAGGTGCGAACACGACTAACAGAAAAGTTTGCGCCCGC
CTGCTTGGACTGGGTTACCGATTCTGATCGGTTCGGGAACCCTCCCGGAT
TCGATAGCGGGCACACTGGTGCAGAAGAACGCGAAAAACACTACGGCACG
GAGCAAACTCACAATGACAAACCATTTGAGCACCAGATTATGTGATATCA
GTGGCCGATAGAGCAAACACAAATAGCAATGTTATGTGAATATGATAAGT
GCACTGGAAAATACATTTGCACCTTACTGGTTTCGTATTGGTAATCTCAA
TTTTGTAATGCTAGTATAAAGTTTAAAAAATTTTATTTATATAGGATGAT
ATATATTTGGATATTTTTAGTATACTTCTTAAGCAATCCAGCCTTAAAAT
TGCGATTTCATTGCGATTTAAAGATGATAATCGATTTTTTACACCCCCGA
TAAATAATAAATTGTTCAATCAACTTATATCTTTAAAAAAAAATACACCC
ACTTGATATGTCATTAACTTTTAAACCCCATAATTGGGTAATTCCTGCCA
ACTGTGCTTTTCCGATCCGGTGATAAGATACGATCTGCATACTCACAACC
GTTTGAATTGTGGCGTATTTCTATCCACAGAGTCAACTGCTTCTTCGCCA
GCTGCACGCTTACACGCCATAGATGCAGTGGAGCCGTAATCTTATCTCCT
CCGAGGAGAGACTTCGACCGCCTACACCCAAAAGATCGGGTTGGATTTGA
TGGGCCGTCGGAGCAAAAGAGAGTGGTGGAAATGGTCGTGTCCGCTATCA
ACTGAATGAGTGGCCATAAAGGCAGCTCAGATTAGCTTTTAACGGTTCCG
TTTCGGCCCGGGGATTTTGGCCGCCGTGCGATTAGGAAGAGCGTTTAGTA
GCCGTCCAGCCGCCACGAAGCAAGCGACTTCCCAAAAATGGCCAATCTGC
GTCCCCTGAGCGCCGAACTTCGTCGCATTGCTGAAACGGAGCTAAACGAA
GTGGAGGAGCGAGTGCCCGCGGATCTGAAAGCTCTTCGGGATTGGTTGGC
CAAGCAACCTCATCTGAGGGCCCGCCAGGATGACCAGTTCCTAGTTGGCT
TCTTGCGAGGCTGCAAGTTTAGCCTGGAGAAGACCAAGTCCAAGCTGGAT
CACTTTTATACTATTAAGACGCTTATGCCTGAGCTCTTCGGCAAAAGATT
GGTGGACGAAAGGAACCTAATCTTGTGCAGATCTGGGTGAGTTAAAAGGC
GCTCATCAAGGATATTTAAAAACTTAAGAAACTTAAATTTCTATTTAGAA
CCTATGTTCGATTGCCCAAACCTTGGGGAACCGATGGCCCCCGCCTGCAG
CTTACGAACTATGAGAAATTCGACCCTAAGGAATTCAAGTTATTGGATCT
CTTCCGCTACCAAACCATGATAACGGAACAGTCAATCCGTGAGGATGACC
ACAGCAACATTAGCGGCTACGTCGAGATCGTTGACATGGCCAAAATGAGC
CTCAGTTTTCTGGCCCAACTGGATTTCACGCTCATCAAAAGGATGGGAAT
ATTCGCTGAGAAGGCACAGCCCACTCGCTTGAAAGGAGTCCATCTGATCA
ATTGCCCCAAGGAGGGAGTGGCGTTACTGAATTTGGCCAAGAGCCTAATG
CCCAGCAAGCTCCAGCAGCGGGTGAGTAGGCAAGAATAATTGAATAGTCG
TAGCCACTCTAGCTAATTTATTTTCGTTCCCTTATCGGACACTTCAACGA
GATTATCAGCTGGTCTAGCAGGCAGCTGATAGGCGTTGAAGAGCTGTGGC
ACTCTCTCACCCCTGAACTATTAATTAATATTTCACAAATCAGAGCCACT
AACTTTCGAGCTGGGTCCGCATACTGTGAAATACTGTGTGTGGAGCAGCA
TTGCCTAAGGTCAGTTGACCACGCACATGGGCTCTTATCATTGAAACACT
GGGCCGAGTTTTAAGATACGGGGGGAAGGTGCAAGTAGATATATCAGCGA
ATAGGAGAATAATCTATTTCCCTGACTCATCACACACATGGCTCTCTACT
TTTTCAGTTTCACGTGTATAAAAATCTCGAGCAATTAAACGAGGTGATAC
CACGCGAATACCTGCCGGAAGAATATGGTGGCAACAATGGACGTATAGCC
GACATTCAGGCGGAAGCGGAGAAGAAATTGCTGTCCTATGAGAGCTATTT
TGCTGAGGATTCCCAGTACGGAGTGGATGAGCAGCTGCGGCCTGGAAAGC
GTGTTAATGCGGATTCAATTTTTGGCGCTGAGGGATCCTTCCGAAAACTC
GACATCGATTAAAGTCGGAACGTGTTTTAATTAGTATTCAATAAAAGGCA
AAAACAATCCTCAAAACAACTAACTAGACTTCTCATGAGAATCGCCGAGA
GCGACGCGACAGATGGCCAAATCGCAGAGCCATTAGCTTTTAGCGAGCAC
TATCTGTGACACTTGTTAATAGCATTGTCAATCACCTAACTAACTAAATG
AAGTGGGATCAAGTGTTGGTCATGTTAATTTGACGAACGCTTAGGCAGTT
CCTCTGCAAAAGGCGTCGAAGCAGGAATCCAACGGAATGGCTTCGGTTTC
CAGCAGCGACGATGTTAGTAATGAGTAAGATTTTCATTTCACCGTAGTTA
TACCTTTTTCATTTAGTTTGACTTCGGCAAATGGGACTTCCCAGCCGAGC
GCATCTGGCTGCACAAGCCCAATGGGGAGATCACCTGGAAGATCTGCACT
TTTCTACCACTGATTGCTTTTGGTCTGTATGGAAACTTCAGCATGGTTTA
TGTGATAGCCACCAACCGTTCTTTGCGCTCGCCCACCAACTTGATTATTG
CAAATATGGCCGTTGCGGATCTACTGACCCTGGCCATTTGTCCTGCCATG
TTCATGGTGAACGACTTCTATCAGAACTACCAGTTGGGATGCGTGGGCTG
CAAGCTGGAGGGCTTTTTGGTGGTGGTCTTCCTCATCACAGCCGTGCTCA
ATCTCTCGGTAGTCAGCTACGATCGTCTCACGGCCATCGTGCTGCCAATG
GAGACGCGCCTCACCATAAGGGGCGTCCAGATAGTGGTGGTCTGCACCTG
GGTCTCGGGTATCCTATTGGCATCACCATTGGCTTTCTATCGCTCTTACA
GGGTGCGAGTGTGGAAGAACTTTACGGAGCGATATTGCAAGGAGAACACC
TCTGTGCTGCCCAAGTACTGGTATGTTCTGATCACCATTCTGGTGTGGCT
GCCATTAGGCATCATGCTTATCTGCTACATAGCCATATTTTATAAGGTAA
GCAAAGAAAGTGTGCTCATCCTGGATTTTTAACTAATAAGCCAACTCAAA
AACAGCTTGATCGGTATGAAAAGCGGGTCCTAAGTCGCGAGAACCCGCTG
ACAGTGAGCTATAAACGCAGCGTGGCCAAGACACTGTTCATTGTGGTCGT
TGTCTTTGCAGCTCTACGACTGCCCTTTACAATCCTGGTTGTACTACGGG
AAAAATACTTCGGTGAAGATGTCTCTGTCAGCAGTGGAATGCAGCTATTC
TGGTACATATCACAGTATTTGATGTTTCTGAACGCCGCCGTCAATCCGCT
GATCTATGGCTTCAACAATGAGAACTTTAGAAGGGCCTACTACCAAATTT
CTTGGGTTCGCCGATGGCGAGACGCCACCCAAATGAAGAAGTTTTCTCGA
TCACCAGACCACTGCTGCTACTGTGCCTTTATGAAGAATGGAAAACGAAC
CTCAGAGGCAGCACAAAAGGCAGGAAATTTAGAAAAAGACATAAGCAAGG
ATATGTCGTCGGCACAACAATCGGCCAAGTCAACGAAGATAGTTGAAAAT
GAATTTGTATCAGAAATCGAGGCAGACGGATTTATATAAAAGAAATTTAA
GAGAAACAAATAATACATTTAAAAGCCAATGTACCAAAATACGAACTTCT
CTCTGCTCTAATACACCCACTATGATATAGGGTACCAAACATATGACAAT
CATACTAAATAAAGCTTTAAGAACCGTAAAATATCATGGCCGGTAGTAAA
AGTTATTTTGCAACCAGTGCACGTGTTACAGTTTGAATGTTTCGTTTTGT
ATAGTTTACACAAAATAAATATATGTATCAAATCTGTTGCAATTTGTTGA
TCTTTGCGGCTGTGATCGCCCGCGTGATCAGTTTTGAAGTAAACTTCCGG
GAATCCTATCCCACACACTTCCTGAACTCAGATCAGGAATCGATGCTCCA
CAAACGGGCGACTGCTGTGCCTCAGTTTTTCGACCAAGGTTTGAAATGAT
ATAACAAACTTTATTAACATGTTAAATTTTGATGGGAAATCCAGTGCTCA
GGCTAAACCAAACAATTCCGACTTCATGTAGCCAAATCCGTGGGCTTCGA
GGAATCGAATGAACTGGCCCATGTTCATGACGCCTTCTTCGGCATTAAAA
AGCTGTTCGCTGAAGTCCTCGAATCCCCGCTTGCGCTGCCGAGGCTCCGT
CCGCACCACGCTGATCTTCTGCCAGCGCAGGGCCTTGATGGTGCGCCAGA
ATTCCTGTACATTTGCCGAATCACCTTCCACGCATATGATGCCCGGTTTA
CCGGGTCTACTGAATCCTGTGAGCTCCAACTGTCGGGCCTGCCGAATCAG
CTCCTGCCGCTTGGCACTGGATTTGATGTGATGCGAATAAATCCAAATTC
TCTGAAGTTCCGTAGCTGGTGGCTGTTGCGGGTCTGATGATGCTACCTGC
TGCACTTCAAACTCGGAAGCTGGTCGTTTTAACAGATCCTCGATGCGGTC
CTGCAGCCAGCTCAGCAGCTGGAAGATGTACGGCTCGGCGTCCTCCTCCC
GCCTTTCACCATGATACTGCTCCAAATCATTCTTTAAGCGCTGCTCCTTG
GATTTTCCCAGTAGCGTAGTGTGTACACTGACGCGTGCCTGCTCCAAAAG
CGGATATAGGTGCGGCAGTTCCACTCGCACTTCCACGCACTGTTTGCCTG
GTAGAGTCAATTTGACCACATACTCCAAATGGGATAGAAGGCTAGTAGCG
GGTTTTGTCTTATCATCCTTGAGAAACTCATTGAAATCAGCCACTACGCC
GGCATCGAGCATATGCAGCTCTCCGGGCGCGCAGTATATGGAGCTCAGCA
GCTCCAGCTCCTCCAGCTGCAGGCCAACGCAGCGACGGTAGGTTTGCAGC
TCCTCATCGGCCATGGCTAACGAAGAGTTAGAAAGAATTGTTTGGTTTAG
TCAGCGGCGACGGATTACCTACGGCTCTATCCTAAAGATGAAAGTACAAA
AAGCTGAAGAGGAATCTTTTGTGATTAGTGTTTGTGCAACTTATTGTCTA
AAACACTTTATGCCTCTTCCAGCTAGCTTTAGTTTCGATGGACTAGAACG
AGTGGCCTCCGTGCCGGTGTCTTTTCCCCTTGACATTTGCATCCTCCAAC
TGCCCACGGTCAAGTACGCTACGGCCTTGCATAAAAATGCCGCAGGAGTG
CGTCACTTTGCCGTCTATACCTGGCGTCCAGCTGAGCAGGACTACCAGCT
CCTCGTGGAGTTGGAAACACCTAAGGCAGTGGCTCTGGATTGCCTGGCCT
TCGCTGGGCGTGGCTACGTAGCAGTGAGCTACAATCTAACAGAGCCCGTA
AGCCAGGCCCGTGAAGGATCACCCATCTATGAGATTTCCCCGGAAACGGG
GATACGGACAGTGCAATACTTTTCGGGAACACATCTGCGTGGAATGTACC
TTCGGATCAGCAGCCAGGAACTTACTCTACTGCATGCCTTCGAATCGAAT
GCGCAGTGTCCCTACTTCAAGTGGATGGGCAAGAGTTTCCAGAGACTGGG
CGCGATTCACTGCAGCAAAGCTCGAAGAATGGAGGCCTTCGGCATTGACT
ACACCGACTATGTGGCCGTAGCCAACTACGCAGATGCGGAGGGACGAACT
GCCACCCACTCAGAGATCTTTCGATGGGATGCCAAGTCCCAGAGATTCCA
ACTCTTCCAGCGACTGCGCAGCAATGGAGCCGTGGACGTAAAGTACTTCA
GTCTCCCAGTAAACGAGGTCAGCCGCAGGCACTTTCTCATCCTGGGCAAC
ACAATTGGCGGAACTGGCGCCGAGGTGGGCGATGCGGACACCGTGATCTA
TGTCTTCGAAAAGGGGCAGTTTGTGCCGTATCAGCGATTGAGTTTCTATG
CCTTGGAAAGGGTTTTGCCAGTTCAGGTAATTTCGGATCAAACTTTTCAT
GGCATTCATAAAATGTGGAATCCTTTAGCACTCAATATCGGAGAAGTTTC
TACTCCTGGTTGCTTGTAATAAACAGGATGTCAAGATCTATAACCTTAAC
GACTGGCGATTCGAGGAATCCAAGGTGCAGTTCACCGAGGGAGCTTTAAG
TCGTGGTGTGGCACGTATGCGAAGCTATGAGGAGGGAGATCAAAGCTATT
TGGGTAAGTATCTTTGGGTTTTTATACATCGTATGCTGAAATTTGCCTAT
ATCCAGTGATTGCGAATGAGAATATGGCTGCCAACGAGACAAACATCTTT
CAGCCACTCTACAAACAAGATGAGCATGCCAACATACTTCGCCAGCAAAT
CATTGACTGGGCTCGGGAGCAAAGAAAGCGATTGGAGCAAATGAATTTAG
ATCATCTATTAATAAGATTGAAAGTAAGTTTTGTGTTCTAAAAGATTCAA
GTAAGTAAAGAATTCATATGTAATATGTAGGACAAGTTAAAGCACCGTGA
GGAGAAACTGAAAGTGTCGATTATCAAGCAAGTGAACGCCAAATCGGTAA
GAAGTAGCAGGAAAGTCAAAATATTTTGATAAAAACCTCATATTTTCAGT
TCGAGGATAAGCACATGAAACTCACACCTAATTACTGGAAGGCTTTGAAG
CTAACCAAGCAGGCCTTGGATAAAATCGAACAAAAAACAACCCTCGCAGG
TTCCAGACATCCCAATAAGAGATCCGTTGATCAACCAAATGAAGAACCCA
ATTTCGATGAGGTCACGGTGGACACGCTGGTGGTGCACGGCGCAGTTAAA
GCAGACCATATCAATGGAGTTGATACGAGGAACCCTGTTTATGATTCCGT
CACTGCCAATAAGGTTTATGTTAGCGCAAAATACACCGAACCCGCCGGAA
AAGAAAGAAAACTTCTGCTGGATGAGCTAATAGTAAAGGATCTGCAGCTT
GATGGGCGACTAAATGGGCTCAAGTGGGCAGACCTGTTTGATCTGACTTT
AAAACGCAGCAACAAAGATGTGCAGTTTATAAAGGCAGCTGCTGACTTCG
ATCATCTGGAATCCGACGCTGCCCAAGTCAACAACAACGAGGTTAACGAT
AGACCGTTGGGTCTGCTAATCCCAGTGGATGGTGGAGACTTTATTGTCCA
ACAAGATGTTCAGTTTTCCCAACCAATTCAGGTGAATCGGCTGCTCATCA
ATCAGCGGCTAAATCATATCCACGTCGATCGTCAGCGCTTCGATGTCCTG
ACCAAGCAGGCAAATCACACACAGGTCATCGAGGGTTCCATGCGATTCGA
GAATGTTCGAGTCATGGAACCGATTACCATTGCGGTGGGTAGCCACAGAT
ATATTATTCTAGGACATATTATAAACTTATTTTTCTTCAGGGTCAAATTA
TGGGGGCCGAACTGAGAGCGATGTCACCGGCAAAGGTTACCCACAAGTCG
CTTCAACTTAATGGGGATTTCGTAGTTGACGGCGATGTGACCATTGGACG
GCTGCTGCAAATGAAAGATTTTGTGGACGAATCTACTCAGAAATCTGCAG
CAGAAGCATTGACTCGGGGCCTGCGATTGGATCAACCTTTGGAGGATGTG
AATCTCAACTTTGTGGAACCACTTATTGCCAACAATACCGAGCTAAGCTT
TATCAACACGCAAGATCTACAAAACCTGGTTAAGCTGAACGTGGGTGAAG
TGCAGTTGGTGCAGGCAAGTAAAATATTTCCTCAAAATGTAGAGATACGC
GATGGATTCGGTGAGATCAAGTGGCTAAATGGGATTGATACGGAAAGACT
CCCGGAAATTATGCTCACCAAGAGTGGCAACCAAACTATTTCGAGTTCAA
TTCAATTACAAGGCGTAGAACTGAACCATGTCAATTCATCACAGATCTTA
TTGAATGATTTGGGAGTTGAGGATTATCTTCAAACAGGTCAGGATCAAAA
GTCAAATGGAACACTGTATATAGACAACATGGATGTGAGGGAAATGAGCG
TGAATGATCTGCACCTAAATGGCCATCTCTTTGGCCAAACAATGTCCTCC
ATCTACGAACATGGAAGCAAGTCCCTGGACAGCTGGCATCTGCCACCCGA
CTTCAATGGCACCATTCACGCCCAGAATCTGTGGCTTAGTGGCCATATTA
ACAAAGTGAAGGTGGTCCAATTGGAGCAGCAGCTGCAGCAACTGGCGGGC
AATGTCAAATACGTTGGCGACTTTACGTTTGAGCATGATGTAAACATCAG
TTCCCTCAGCTTTGAAAACTCTCTAAATGGAATTGAGGCCAATAAATTTG
GTAGCTGTTGGTTGGAGACCGACAGGGACCAGACTTTCACAGCCCCGCAG
AAGCTGGCTTCCCTGGACAGCCAGCAAGGTCTCTGGCTAAGAGGGCAACT
GAACAACCACACCTTGCAAGATCTGGAGAACCGTAGCTACAGGCTCAACT
CACCGGAGCACCTGCAATCAGTGCGATTTGGTGGGTTTTATAAGAACGGC
TACACGTTATCAATTATAACAACATTACCTTTCAGCGAATCCCATTGTGT
TGCAATCGGAGCTACAGTTGGATCGCTTAAATGGACTCCGCGTCCCAGAG
GACGTTATTTACCATAATGGTGGAGCTTACATCTCTGCTCCCGTTAGCGT
AGATGGTGACCTGGAGGCTTTAAAATTGTCCAACATAACCAACCTGAATG
GTTATCCTCTGGAGGCGTTGGAGATCTATTTAAGTGGGCAAAATGTGCGC
ACCTTTGTGGCGGAGAATGTTAAGTTTGGCGGAGAACCCTCTTATCAGCT
CCTGAATGGCCACAATCTAGGAAACCTTCTTGATCAGGTGTGGCTGGACA
ACGAGCAGATTGAGTTGAGAGAAATAAAACTGGAATCTGGGCAATTCGAA
GGCCTGCTGGAATTCCAGGTGAGTGGGTATTGCACAGTAGAAACCTATGT
TGTTTACAAGAACACCTTTCCCCATAGGGACCCATCAACGGGCACCAAGT
GGATCATATAACTCACAACTACTTCAGCCGGACGCGTAGCAATCTGCTGA
AAACTCCCCTGAGCTTCCAGCATGACGTCACGTTCGCACAGCCTCCAGTT
GCCAAATACGTAAAACTACGACGTGGCAGCAGCGGCGTTTTAATGGAGGG
CACCAGTAGGTAAGTGAAATTGACCAAATGATCAAGGGGCAGGGGGCAAT
GAACAGGGGTAAAGTTGGTATCACGTTTCACTTTCGCAATTGTTTACGCG
CTAACAGTTTTAGAGTCACTGCATCCGCAGAAGTCAGCTGTGCATTCCGT
TTGGCAGGTGAAATTTCTGTACACGTTTGTACGTAGCGCGGGGCGGGGGT
TGCACTTAATTCGAACACTCGCAGGTGTGCTTAATTACCTTGTCAATTGG
TCGCTGATTGGGTTTGGTTAAATGCACTTTTTACGGTCGGGCAGTTTCGG
CAGAGCAGAGGTTTGTGATTTGAAACAACAAAAACGTCTTCGCTAGAATC
CCAAACGCCTGGCAGCTGGGGATGGCAGAAGCATCGGTATATCGATGTTT
TCACAACTATTATCGATCTCTACAATAATCGTTGAATTTAAATATAAATC
GAATTTATAGAACTTGGGATTAAAAGATTAATTATAAATCATTTTCGGAT
CATAAATATAAGTACTACTCTATAAAACATTTTTTAAATTTATACATGGC
TTTACTCTCGCCTGGAATTTTGTGAGGAATACCATGCTACCAAATGGTTA
ATACTATATTAAAATAAATCTTTTTCATTTCTTAGCAACTTCTCCCTAGA
TTTTGATGATTTTGTAACTCACTCGTTGAAAACAGCCGGCTCTCACGCTA
TAAGTGGATATTGGAAACTGCCTGAGGCCTTTATTTCGGGAAATCTAAAC
GATATTTACATAAATAATTTAAACCTTGCTAATGATGTCGTTAGAATGCC
TCTTCAAAATGACAGTATCAATCTTCCCTTGATAGTCGAAGCATTGAAAA
CTGTCCAGGGCGGCACTATAAATCGTCTCCATACAACCCCTGAAAGCCAG
GTGGCGGATGTGCCTGTGGCCAAGTGGATCCATGGAGCAGCCTACCTTTA
CGGGAACCACAGTATTTCTGGCATTACTCATCTGAATAATGTCAATCTCT
ACAACGATCTTACCGTGAACGGGTCTGTAAATGGTGTCCCCTGGCAGGCG
GACAAGCTCATTTTGATGGACAATGAGCAGGATATACCGGGCTCCCTGCT
GGTGGCGAATAGTCTTCCCGAACAGAAGCGAGTTATGAGCAATAATGTGA
AGAATCTCTGGGTGGATTTCGTCAACGATCTGCCCGTTAACGAGTTACTG
GTCAGCAAGGCAGAAAACCGTCCCAATCTTCACGTGGAAAGCCAACTGAT
CTTCACCCAGCCCCTCACTGTGGGTCACTACGAAGCGGGCAACGGAAATG
GGCTGCTGGATAAATATTACAAGAAAAAGCGGGGTGTCGAATCGAATGAC
ATTCATGATTGGCAGCAGCTGCAGGAAAATGTGGCAGCTATTAAAAACAG
ATTGGCCAGTATGTTAAAAACACATTAATACAAATTCTCCTTTAGTCATG
TGCATTAAATTCAACCAACAGAGCCGCCTAAAGTGCTGGAAGGCTTTGCT
GTGCTGCAGAAATTACCTCATAAGGCCTCGCACATGAAGATCATCTCCGT
GGACAACGAGGACGTACTGGCCATCTGGGAGCAGATGCCCAGCGAAGTAG
GGACTACTTACACATGGCAACCGGATATACATCTTTTTGGGCGAAGTTCA
AGTAAGTTATGTAGATTTATTTGCATATAAACGTATTTTAAAATCAAGTA
GCATATTCAACCTTAAATAGGGACAAATTCGAAATCTCAAATATTAGAAA
TACATTTTAAATTTAGCTTTAAAATTCATGCGTAAATGCTATGAACACTC
ATACCAGAACTGTGAGTAAATACATTTTACAAGTGGGCGGCACAGAACGC
AGACGTTTGAACACGGAAAAAATAATACGATAAATACGAGAAATGGTTCA
GACAGGCCTACTACATAACTACCTTTTTAGTTTGTCTAATAAGTAAGCTG
AGTAATCATTTAAATTGCGAGTATCAGTCGGTCTACTGCTCCAGTTCGTC
GCTCTGCACATCGAGGATGGCGCGCAAGATGGACAGCTCCAGCTTGGCGG
AGGCACGCGAAGAGAGTCTGTTCATCACATTGGCCACGTACAGCCCGAGA
GACTCGTGTCGCGACGAGTTGCATAGATTCTTGAAAAAGGTTGGCGGCAG
CGAGTTGTCAAAGTTGCCCAGGTTGATAATCTCGGGTGTATTGGAGGAGG
CGGCGTTGATCTTCGGCCCGAAGATAATGTCATTCTTAAAGTCCAGCTCG
TCGATGTGTGGCGAAAAGCCGTTTGTGGAAGCCACCGAGGTGGAAGCAAT
GGTGGCGGCTGTCGATGAGTTCGCTCCCCCACCACCACCGTTTATCTGTT
GTGCCGATGGAATGGTGATGATGTTGATACCCGGCGGTGGTGTCTGGTTG
TCCTCACGCTCCTTCTTAACCTGCATCAGCTGGGCAGTGGTTGTGTGCAC
CACATTGTTTCCCGCCGGCAGTTGATCTGGAACGCTGGTGTGCACTGAAG
TTGCGGCTGCCGATGAAGCGGCTTGTTTCGGGCTCGTGGTCTTGGTCTGC
TTTTTTTGCGCCGATGACGAGGTGTACTCCTCCGAAAGTTTGCGCTTCAA
AGAATCTGGCAGCTGAATGGTGGTGCGCGAGGAGCTTGATCTTTGCCCAC
TGGCTGGCGCCTGTTGCCCAATAGCCGGTTTCGGTGCTGCTGCGGAGCTG
GGCGTCTTCTTCACAGTAATTCCCTTCTTTTGCAGTACTGCTGCGGCGGC
GGACAGCGAGCTACTTCGCGGTGTGTTGTTAGCCAGTGTGTTGAGCAGCT
TTTTCTCCTCGATGGCTGGGCGAGGAGTGTCGACGTTGGGTTTGGCGTAC
GCCAACCGCTCGTCCTTTTCTGGCGAACCGGTGCTGTGTGACTTTGTGGG
GCTTTCGCCGTCGGAGGACGCCGAGCCGGTAGAGTTGGTGTGCTGTCCGT
ACTGATGGGCGTCATCCTCGTCCTCAGGCTCCTGCACCTCCAGCATTTCG
TACTCCTCCACCTCCTCCATGGGTACTTGATCACTGCAGAATAGCAGTAG
AAATTTTGTTAGTGTTTCACGGTTAGAGGACTATTTACGCCACTTACTTC
TCCTCCTTGATTGAGATTTTAGGCTCCTGATGGATCTGATGCATCAGACT
GAAGAGCTTCCACGCCGAATTGCCCTTTAGCTTTTCCTGCTCGTACTTCT
TTTGGAGCACTATGAAGATGGAGCGCGATTCGTGCACAGAGAGCTTGTTG
AGACGCCCGATCCTGGCCCACGCCTCCTCCTGCTCCTGCTTGCTGGCGCC
GCCATTGTTTGGATGCAGCACCTTTTCTTTGGCGATGTCCTGCAGAATCT
TGTCCAGTTGGATTGCCATCTTAGTCAGCGACTTGCGGCCCGCTGGTTGC
GCGTTCCTGATAATTTTGGAGGCTGTTTTGATAACACGCGACACACGAAT
TGGTATATGTAACTAGGATCCGCTTGTTTTTCTCTCCGCTTTCGCACCGT
TCGCTTCTCTTTTCTTCTGTATTTGGCGTCGGTAAATTGGCGGAAAATGT
GACCGTGCAACACGCAAATACTAGAAATGCCGCCTTTTGGTACAGTAACT
TAGGGATGAGGGAGATTTTGGCAACATAGATGTTCACAGTTCACAGCTCT
CGATGCAGTGAAAATTAAATTTTTATATATTATATTTATCACTATAAATA
TTAATACTTGCATTATTTTTACTTATATAACAATTATAATGTTTCTCCAT
AAGGAAAAGTTATTCATTTTGGTAGTCATAACTATCGAAGGAATGGTTTT
TGTTTTGTCTTTTTCTATTCTATTCTCATACTTTATTTATTTATTTTATG
TAAGGATCCTTACATATCGATAATTCTTAATACCGCTAATTTACGGTAAA
ACTACCCGTCTATCTTGCTGCCGATAGGGACAAACAAATAACGCAATTTA
TATTGCAGATGAGAACTCCACGAAATTTAAATTTTATTGAAATACGTTAC
AGTTTTCGCCACCTCACAACGCCACGATATTTACTTTGTCCTGACCACCT
ATGCATTTGACCGTTTCCAAGCGCGTAGGCCCATCCGCTCCGGCTGGACT
GCTAACCATAAAGGGGAATTCGGCCAGGCCGTAGCAGGCAGCGCCATAAT
TACCCAGCCGATCTACGGCGATGAGAGCACCCATGAAATCCTTGTGGTGC
TTGAGAATGCGGCGAAGGCCCTCTTGAGCTGCCTCAGCCGGAGGTTTTCC
CGCCCGCATGGTCTCCACCGCTAGCAGGGAGGGCAGGAAGCGCATCATCA
CATCTCCATCTCCGGTTGCCACGGCTGCACCCACCTCGTTGTCTGCATAA
GCGCCAGCACCCGGAATGGGGGAGTCGCCGACCCGTCCGGGAATCTTGTG
CCGCGCCCCGTTGGTGGAGGTGCCGGCGTGGATGTTGCTTTCCACGTCGA
TGGCGATCATGCCGATGGTATCGTGGTTCTTGCGTCCGATCTCATACTCA
TTGCGGGCACGGTCCTCCTTCCAGCGGGTCAGCGGAGTCGGCCGCGGCTT
ATACGGGCCGCAAGAGACCTTGGGATCCGGGTGAACGTTCTTCCAGAAGT
TTGGCTGGCAGTTCTCAGCCGTCCACTGTAACCACATGTCCTTCGACTCC
GGCGTGACCAGCGACTCTGATTCGAATCCCATAGCATTGGCGAAAGCTGA
CGCCGCATCACCCACCAGCATGGTGTGCTGCGTGTGTTCCAGAACATGCC
GGGCTACCTTAATGGCATCCTTAATGCGTCGCAGACCAGCCACTGCCCCC
ACATCCATGGTGGCCCCGTCCATGACCATGGCATCCAGTGTGGTTTCGCC
CAACTCGTCCGGCGATCCGCCATAGCCCACCGTTCGGTCACACTGGAGTT
TCTCACACTTCGAGCAGCCCTCCACTACCGCATTCCGCGTCTGCCGGAGT
CCACCCTTGCTTTGCTTCAGGATTCGCCAGGCGAGCACATTGGCAGCCGT
GAAGTTCCAAGTGTTAATGACCATGGGCAGCAGCTCACCCGTCGTCTTAT
TCGCCTTCACGGCAGTGGTGCCAGCTTTTCCACTGCAAAGGGGCGGATCT
TAGCGAACAAAGAATACGCTGTATGCGCTGCTCACCTAAACGCCGAAGTC
A