P[acman] BAC CH321-60E02

CH321-60E02 is on chromosome arm chr3L from 12419910 to 12515542.

BACPAC Resources is the distributor of clones for this project. Investigators requesting a clone will need to establish an account with them. They will also respond to all questions regarding shipment and availability.

Return to the Browser

The sequence for the BAC is deduced by extracting the sequence from the reference genome between the alignments of the BAC end sequence. The sequence of the BAC has not been confirmed over its full length, nor has the sequence been aligned to the MboI restriction sites (GATC) used in the BAC library construction.

>CH321-60E02 95633bp
AGGTGATCTCTAAGGTAGAAAACAAAAAAAAAAAAAAATCATAAAAAACT
CTGGCGAAATAAAATAAAATCGCTCGAAATTGCACCAATTAAGGGGAAAT
GTATGGAGAGGATCGTCGAGGACCAAGCAAAAAATAAAAAAAAAGAACAG
AAATCAAAGGGGGGGAATGCAGATTGGTCTGCATTTATCAGCGATATTAA
AGCGTTAAGTGAATTACTTATTCTCCTGGTCGCAGCAATGCGTTACCTTT
CATGTCCTCCTGTCCGGAGGATGCCCCTCTCCAATCCCACCTGCCCTCTC
ACCTTTTCGAGTTGTCAATGCCGATGTCGATGGCCGCGATCTTGCATGCG
ACAATTATATGGGCCCTGTGCTGTGCTGTGCGACGCCAGTTTGGCTCCCG
ATCTCATGGCCAAAAGCGGCAGCTCTCTGAAAAGAGGGCCCAAATCCAAG
GGGAGGGCGTATGAGCTGGGTGCTGAGGAGCCAGGACTAGTGATCCGGCT
ACCGAAGACGCAAGGCTTTGGCCATTCTGGTGCCGCTCTGGTGCCGCTCC
GCGCCGCTGATCGATTCGCAGCCAATCGATCGGCAGCATCATGCAACCGC
GCACAGCCTTCAGCTTCAGCATTTGGAGTGGAGATCGGAGCACAGAGGTG
GATACCAAAGGGGGTTCCATGGGGCTAACGAAACTCACAAAAGGGAACTT
TGCTCTCAGTCATTCCAAGGCTACAGCAGCCCTTTTAACTAAGATAAGCT
TTAGTTAGATGACTCAAAGTTTAAAATTCATATGATTTTACTTTAAGCTC
CCTTTTGGACTTCGCCTCTGTGCTCCAATCCTCAGCTGGGACCCATTCCT
GCTCCTTAGCTTAACAAATCGTGCCAAATAACACAACATAATGACAACAA
AGCAGACGACGACGACGACGACTCCGAGTCCGCAGACGATGTCCACTTGG
CTGCCTTTGGTCTGGGATGCTGAGATGTTGGGATGCTGGGTTGTTGGGGA
GCTGGGAATCGCAGGTCGGTGATTGCCATTTCAAGATTTCGCCACTCACA
CCAGCACACAACGTGGGGATGGCGAAAATTAAGAGATATTTATAATAAGC
ACGAAAACCACTTAATACTAACGCCTTTGGCAATTAACAGGTACAGGCAA
CGGACAACGGCTGAATTGGCGGCCAGGATGCAATCGGAACTCGAGGATGA
TATGCAATCCACTCTCGCTTGGATACACCAGCTCCATTCAGGGACACTGG
CTGTCACTAAGAAAATGGAGCGGCACATTTGACCCCAAAGCGCCACTTTG
GACACAAAGGCAATTTCGGGGAAAAACTATTTCAATCTGACAGATTCACT
GAGATAAAAGATTTTTAACTATTACTAACAAAAAGCTTTGTCTGCTTTAG
GATATTAAAAAGTGGCTGAAAAGTTGGATTGACACTAAATTGGGGATATA
TTTATACAGATTATCAGATATAACGACATAAAATATATAGTAAAGGAAAT
GAAGTGACGTATTTATTTCAATTTTTCCGTATTTATTTTCCATTTCTTGA
ACCATTTGAAACAATTATACATATTTAAGCCCAACCTAAATCGATTTATA
AGAAATAAGAAAACAAGGAAAAACTCTATAAATATATGTACATTTACTTT
TCTTCTGACTGAATGCCATATCCATATTTTGTATGTCATTTTAATGGCGC
CTTGATGACAAGAGAGACCCTTGTAAGCAGCGCATGTCAAATGGACATTT
AATCGAATTTTTTCCGGTGTAGCGCTATCTTGTGGAGCACAATTCATTTC
GACGACTCATCGAAAGCCGCAGGTATCCATCCAGGTATGGAGATTCAGGC
ATTAATTGTTTCGCATTCCCCTGGCGTCATTCTTTCATCAAAGATCGACG
CTGGAATTGACGCCTTCGGTGGCTCATTACAATCCGGACAATCAATAATG
GATGGATGGATGGATCGGTGGATCGGTGGATCGGTGAATGGATGGGGGAT
AGGAGAAATAGTTGGCGCATAGCGCGATTGATTCTCACCGATCGGCGATG
AAATGAATAACTGTTTTCGGGTGCTGCCCCCGTGGATCAACTTGAATCAA
CTCGAATCATCTCTTGAGCGAACGATTATGGCAGTGGTTTTCTGATTTGA
CAGGCGTTAAATTAAAATTTAATTCGGCCATCTATATAATTATAGTGATC
CATCCGAGCATACACATTGACGACAAAAACGAGGACGGCGACGACGACTA
CTCGCCAGCGCATGTAATTAAAGCCACATTAATCACCCGGCTCCAGCGAT
GGATCCCCTCCACATCCCCCCCAGATCCCCACCAGATCTCATACCCATCT
CTCGCCAGGCACTTGAATTGGTTACTGTGGAGCTGAAGCCTGTGCCTCTG
TGTGTCTGCTTTTCACTTCGCTTTTGGTAGCCACAAAATTGTCAGATTTG
TCCACTTGAGTTATTTTCGAAAAGACTCTTTCGAGATCTCCATGCCTCCC
CCCCCCCCCAAAACCGTTCCCCCCTCGTGTTTCGCCAGGTGTGTCAAAGG
GTGTCATCTTGTGAATTCCCAAACCAATTATACGAAACTCGTGAGAACTT
ATCGTTTCGATTTTATTTGTACTCAGCACGCGGTTAGAAGTTTTGTTTGC
AGTGATAGAAACTGAATAAATTATGTAAAAATTGCACTAAATTCTCGATT
TAAAGCGATAGGAATGAAATGGTCACTCGGCGTCGTGCTCCACATTGATA
ACCTCCTCCTCCTCCTGCTCATCCTCATACTCTCGCTCCTCCGACTGATG
ATCCCGTCCAGACTGTGCCTGGATTGGTGACGAACCATGTCCCAGATTGA
GGGGCGTGCCCATGTACTTGGCTATGTACTGGCGGGCGAAGCTGAGCGCG
AAGGCCGCCGCCGATGCCGTGGGCAAGGTCATGGGCATCGGCAAGGTCAT
GGGCAGAGCGCGAAATGCACTGTTCTCACCGCCCATTGATAATGGAGCTG
ATGCTGTGGGTGAGGCAGTGGCCACCGCCGCTGCTGGCTCTTCCATGTGC
TGGTTGCTGCTGACGCTGCTGGTTTTGCTGCTCATTTTGCTGCCGGGATT
GATGGTGTTGCACGGTTGACTGTTGCTGCTGCTGCTGCTGGTGTTGCACA
TGTTGCTGGTGCTGTACGGATATGGCTGCTTCTGTTGGCCAGATTCTGGA
ACTGCAACTGGAACTGGAACTGGGATTGGACTGACCGGACTGACCACCGG
ATTGACCAACGGCGTGGGTGAGCTCGATGTCGAGGGCGAGTCGCGCTGCT
TGATCAAGTTGACCCGCTGGTGGCGCCGCCATTTCGCTCGTCTGTTGGAA
AACCAAACCTGGTTGATCAATCGGTGAAGAGACAATTTGTTAGTCGATAA
AAAAAGAGACGTGGGATTCACTGTGTGTTCATCACCGGAGCTGCTAACTG
CTAGCTCCGTCTGTGTGGTTAGTAGGGGGGTGTTCGAGTTGGGATCTTGT
TGCTGGTATGCCAATAATAATGTAGGTTCTATCGACTCACCTGCACCCTG
GCCTCGCTCAGTGCCGTCCGGGCGGCCAGTTTCTCGCGGGTATTCACGCA
GGGATAGTGCGACTTGTCGAACTCCTTCTCCAGCTCATCCAGCTGCTCCG
GACTGAAGGTGGTGCGATTGCGCCGGAACTTCGGCTGGTCACTGTCCTGC
GACTCGCTGTCCTCGCCTTCGATATCTGCAATGGTATATATGTTAATTGA
TTCAAGAAATCAGGCTGTTATAAGTGCTTAAGTTGACTCACCTATCATCC
GATTGGCATCTGCGTCTGGGGAGCGGCTGTCCCTACTTCCGGAATCCGGC
GAAAGTGCCGGCAGGGAGAGGCGTCCACTTCCGGCACTACTATCCCCGCA
TCCACTGCCGCTGTTGGTATTGTGGCCATTGCTGTGGGTGGTGTTGCTGT
TGCTGCTATTGGGATTTGAGCTCATGTTGCCATCACTGCCATAGCTGCTG
CCACTGCCGCCCGGCTGCAGTGCACCACCGGCTCCAGCAGGGCCGCCACC
AGGTGGCGTGGCCAGGGGCACGGCTCCCCACAGCGGATGATGCGCCGGCC
AAGTGGGGAAACTGGTGTACGGATGCGGATGTGTGGGATGGATGGCATAG
CCGTAACTCGCCGCCCGAGCAAATTCCGCAGCTGCCCTTTCCGCCGCTCG
ATTACGCAATATGCGATTGATGCTGCTCACCGAAGGAGCAGTGGCATTGG
TGCAGACACCTTGGGGATATGGAATGCATGATTAATTTGAAATGATTTTC
AAAAATACTATTGGGTATATTCTAATACCTGAATACCTTCTCTTGCTGAT
ATCTCTGGACTTACTTGCTTGCCAAGATTTTCTCACTTTTAAGGAGTTTT
TCTGATTTTACCCCTAAATAGCTACAATACCTATAAAATGTACATTATTA
TAGTGAGCATGTGAATTAAGTACATGTCTGCAACAGATTAGCTGCTGAAA
TAATTCCTAAATCTCAACGCATAAAATCAGTTAATTTCAATGGATATTCA
CAAGAAAAGGAAACTGATTTGTATACCCATTTAGTCGCTGTCTCCTACAC
CGGATGCTGTGCATCATGACCTGCTGGTGACCCCGAAATGAGCCGAGCAG
ATTGACTGTAATGAGCGGAGCGATTGCCATCTCGCCATGTGTGTGTTCGT
GCGTCTCATGCGAGAGATTGCTATCGGATCGATTCATTGCACACTGTCCT
CCTGTGCCCAGTGTCCACTGTCGCCGGTTCACTGTACACCGTCCACTCTC
CGCTCACCCCTGACCATTTTCCACTGCCCACGGGTGCAACTGTCAACTGA
TGGACTGGTTGCTGAGTCGCCGATTGGACTACTTAACTGGCTCCTATTCT
GGCCGCGATTATCTCGCAAACTTTGGCGGAGGGAGCCCGAAATGAGTGAC
ACAAATGTGAGCACATTTACATATCAATCGGACGACTCGCAGCGGATGTT
CATAAATTAGCCGATCGATAAATCTAAATCTGCCGCAGTGGAACAATATA
CACAAAATACATACATATACATATATACATCCTACCGATTCCTTACAACA
TTAAATGAGCCCTCGACGGGCAGTCGAGCATTACGAGCACCATAAACACA
TCAATCCAGTGCCGATGCCCGATGCTGATGGCTGCTCCTTCCAAGTTCCT
CCTGTCAATCTGAGGGAAGAGCTGACGGAGCTGGGAAGCTGAAGAATCTG
GAGAAGCGCGTAAGCGAGTTGGAACCAAGTCCAGTCGCCTGTCGCGACCG
TTGTCATTTGTTGGCCAATTTCGCTTTCGGGGGTTCCCTGTCAGTTAATT
AGCCCAGCTACTCGCATTGTGTCCCTACCCATTCGATGCTCCCTACTCAC
TACTCCCTACTCAATATTCCTACTTGATAATCCCAATCGGTATCCTCCTG
GTCTTTGTTTTCCATTCACCTACCTTCGGTGATCAGTCGCTCGCGGATTT
CCCATGCAAAGATCGTCGGATTCTCGCGCTTGTACTGCTCGATCTTGGAG
ACGACAGTCGGGGTGGCCACCTTCGGCTTGGAGCCGCCAATTAGGCCAGG
TGGTCGCAGGGTGCCTGCAAGATGGATAAATTGGGGTTTCAACAATGTAC
TACAGTATATGGATCTTAAATAGTGGGGAAGTTATATGAAAACTAGTGAA
ATATAAAGTATCTACTTAGTATGGTTTTTAGTTTTAGCAAGTACTAATCT
TCCAATTCTAAAGATTAAAATCAGTAACTTCCTACCCATTTTAATATTAT
TCAAATTGATATTGATTTATGTTTAATCATCGAAAACAACATTTGTTTTG
AGAACAAATTTAGGCCTGATTGTGAAAAATGTGGGGATAGTTATCGAAAT
TAATTTTGGTAGCCGCGAAATCTGTTCGCTTTGTGGGCGTGTCCGGCTGT
TTAAACTTAAGTAGACACATTCCCCATCCCAGTTGTGCAATCAATTTGAC
TGTTTTACATTCTATTACCACTTGGGCTGACTTGGGTGCCTTCGGGCTTG
AGTATTGCGAATATTGTGAGTATTGTGAGTATTGTGCGACTCGCATAATT
TTCACATTGTTCAAAGTTGGCGTGGCCGTGTGGGCGTTTCGGATGGGTCA
AAAGCCCGGCGGGCGCAATGCATTGTATCGCTTTTGGAGGCTTCCACACA
CCAGTTACTAGCTACTAGCTACTATCTGCCAGATACTTCCACACATAGCA
GATGGGAGATGGAATGGCAGATACCTGCTACCTGTTGACTGCCTGCTCCG
AGCCACTAACTAACTAGACAATTAAGCCAGCAGCCGGCGTCCATTCAGCG
TAGCGCTAATTTGAATATTTGACAACATCAGCTCAGCGGCCCCAGACTCC
AAGTCGCAGTGGCAGCCAGCCGAGTCACCAAGTCACCAAGTCACCGGAGT
CACAAAGTCGGCTCAAATGATAATTCGTCGGAAGCAGTTCACAGGCGCGC
GCGTTTATCTTGTAAATTGAGCTCTGTCGTCGGATTACACTGCAAGAAAA
TGCCAGTGATAATCACTTTAGATCGCAGAATTAGCGGGTATTAACTTTGA
TTCCAGGTAATTTATGACGCATCTCGTAGATACTTGATAGCAAATGTAAA
TATATATACATTATAAGACATTCATTTCAGTCAGGCAAATTTCCAGCAAT
AAAGAAAAATCATAGTTTAAAATGTAAATACCCTGATTAACTAACATTTC
TTTGGATTTACTTTGCATTTATCGCATTGGCAGTCGGTTTTTTTTTCTCG
GCGCATTTGGTTGCCTTAAATTAATGAATGAATGGGCACAAATGTACTTG
CACATTTGTTTTCTAGCTGGCTTTTTGAGCAAAACGGAAATTATTTACAC
AATTTCAATTGACTGGAATGGGAATGAATGGCATCCACAGAGATCGGATG
CCGCGATTGAAAGCTACGCTAGTGAGTATCTGTGAATGGGCAGATTTATT
TGGCGTATCTACTAAACTAGCTAGTGACAAAACAGCACTTCCCTAGTTAG
TTGCTATATCATTTGAATTGCGGTTTGTAAACTAATTATTGTATATTATT
GTATTATTGTATAAAAATTATAATAGACATTATAGTAACAGCGTTTAAAG
ATAAAGATATTCTCATTTCAGAGTGGCAAATTTAATTTAATACTTTTGAA
TACTATTGTTATTGTTATTTGTTTCTAAGGAATTCTTTGTTTCCGGCTCA
AGATCTAAGCTTGCAATTCAAATTGGCCGTTTCGAGTGCAGATGTGTGCA
AATCGAGATTGACATGGCTGGGTATTCTGGCCACAGGTGGCAACAGGTGT
GCGGCTGCTGCAGACTGCCTCGCGAGGTAGGTGAGAGGACAAGGAGGGCG
TCCAGGTGCAGATGGGGGCGATGGCGATTGCCAATCGATTTGTCGTGTTT
ACGTGACCCCAACTAACGGAGCCGTGCAAATCGATTGGGACGCTTGGTGA
CACTTGGCAATTGCATTTGGGGCGCGTGTTTTGTGGTTCCGCTGCGGTTA
ATGCCGCTGATCGCATTGGTCAGGGTGGTCTAGACCACGTCTGACTTCCT
GCTTTCCAAATGCCCTTCGCAACTACCACCCCCCTTTCCCTTACTCACCC
AGCAACTTGGATACGGCTCCTTGTTGGGATAGCATATGCTGCGCCAGATC
ATATCCACGCAGTCCGAAGCGGGACAACTCCAGTAGTCGATGCTGCGAGG
CCAGGGCGTTGAGATTCGTGGCCGCCGCCGCTGCTGCTCCTGGTCCCGCT
GCTGCACTGCCTCCGCAGAAGATGCCGCCCAACGCCGCAGCAGGGGGTGC
TCCTTGGGTGAGGATGGGCGTGGAGGGGCTCAAACTGTGCGGTTGGGCGA
GAACTAAAATGGGAGAGCAGAAAAGTAATCATCAGAGCACAGAAAAAAAA
ATCTTATGATTTTATCTGATCTTGAATAATAGACGTACATTAAAATAACT
TATACTAGTTCATAAGTTAAAGATCAATTAGGCAATCAAAATTAATTTTA
ACATAAATAAATACTTCTTATTGCTCATTCTTTTGTATACCCAATTTTTC
TTGGTGCAGGATCGCCAAATCATTAAACGTCAATTGGAATTTAAACGAAG
CTGTTGCCGGCATTCCGCGCGTGACACAGAAACACCAAGAAATTTGTAGC
CCGATCATCTGGAGAGACTGGGGCTCCAATCATTTTGGGGGGCAGCTGGT
ATGGACAGCGAACAGAGATGGCTGGACAAATTTCGGTGTGTGTTTTTGAT
CGACGACGTCAAAGTCAAAGTCGAGCCAGAAGGAGCTGCTCCGTCCTCCA
TGCCTCCGTCCAGTGGCGGAAGTGTCAACGTTTATGGGCATAATGGACGC
GGTGTGGTCCATTACCGCTGACACCGACTGTTGATTCCAGTCGGAATTTA
TGAAATTCTCGCTGGCAATTTGTAGCTCGGAGCTGGAACTCTGGATCTCT
GGATCTCAGTATCTCTGTATCGGAATCACAATCGAAATCGCAGAATTGCG
GAATGGGATGGCAGATCGCTTGTCAGCGGACTGGCAGCAATTGGCCATTC
CTCGGATGTAGAAGCTTTTATGTTCATTTTGACATTTTATCTGATCGCGA
GAACTGCACACATTTTAACACCTCTTTTTTGGTGCGATCGAGCTCCGTGT
GTGGCGACGACGGCATGCCATCGTTTTCCCAGTATGCACTTCGATTGGGG
CATCTCCTCCAGCTTCGCCAGCTCCTGGGCTAATTAAACCCCATGCAGAT
GGGACTGGGAGCTGGGAGCTGGACCTGGACCAGCTTACTCCATTTAAAAG
TGCCCGGCTGCAATTTGTTGCACTCGCATGTTGCGCCAATTGTTGTGGCC
GCGGTTATGGCCATGCTTGATTTATGCCGCCGCAACAGCCGGCCAACTTG
GATGTCAACAGGCGGTGAGCTTGCCCCCGGATTGCCCCAGTCCCGGATCC
TGTTGCCTGTGTTGCAGTCACAGTCCAGATTCTATGGATCGACCGATGAT
TTACTACGCAATGCGACAGCTCCGACTGCCCTGCGATGCGCCTCAGTCAA
TTGCAAAAGCGGCTTAAAATCGCTGGAACCACGGCCCAAAACCAAAGCCA
CTCGCTCTTCTTCTACATACTGTACACTGACATTTTTAATGGGTGTTTAT
CCTTATATGGATTAATATGTTAGTGAGATGCTTTCCTAGTATAGCCTTAT
ATTCAGATGAGCGCTTAATTCGAAATAGAAGATATTATATGTTTTAAATA
TACATAAATATATAATAACATATGTGGTCTTGATTTATATTAAATCTGTT
ATTATAGTAAATTAATCGAGAGATAATAATTTAAAGGCCAAACATTATTT
ATGTATTGGTTTATATACAATACATATGTAAATGCTAGCTATTGCTGATT
TAAATATATGTACATATACCTGCCTTTAAATGAGTGTTAATAATAGATCC
CTCAAACTCGTACTCTTTCTTTGGACTCAGTATGCATTTTTCTCAGTGCA
TTCGTTCGCACGTCACCGTGAGACTTATAACAAGAAGCGATGCCGATCGG
AGTTGGACTAAAGCTCGAACTCGAACTGGGGATCGCAGCTCGCCACAAGT
GATGATCGCCTCGGAATTCAATTGATAGTTTGATTTATTGCTACCGGTAA
CTTTTTGCCGCTTCGTCCCCAGCCCCCCTCCACCCCTCTCCATCACCATC
CATCCAGCCAGCCAGCGCATATAAATTAAAGTTGCTCGCTTTTTATGTGG
CTCCTCGACGCATCCCCATCCCGATCTCCTCTAACCACATACCCATCCCA
ATCCCAATCCCAATCCCCTTCAGTTAGTGCTCGCTGATCTTGTTTGTCGC
GCGCAGCGCATTACTCGTCCTCTGGAAAGCGAAGCTTCTGGTTTTTACTG
CCAGTGCGCATTACTGCGATCTTCGCACATTTTCCTAAGCTCCAAGAATT
TTGCGGCGGGGCGACGTGCTCTTACATAAGTCAGTCTAATTTTATGCCAT
CCTTTATTGGATTTCATTGTACGGCTCTGGCTTATGGTCCATGGCTATTA
ATTGTGGCTAACCAGTATGGTGCAAAAATGCAAATTGAAATAAAACACCT
TTATCTTTTCACAGATGCATAATTGCTTTTTAATTGTGTATCTAATTTTG
TATGTTTATCTCAACGATGATAAAACGTAGCCTTGGACAAATCTTTTGGG
ACTATTAAATTGGATTGAAAAAATATGGGTGTGTTCCGTATCACTTAAAA
TTTCAAAATTCATAGGAATATTAAAAAAGTAATGATGTTGTACGGGAATT
AATCATTGAGGAGAACTGATATGAGTTTAGTTTGGAGATCTTTACATTGT
GAGCTATACCAAATAAAGTTATGATATCTATTTCTAAAGGTAGCACACTT
TAGTAAGTACTAATATTACTCTTTTTGCATATTGTTAGCAATGCCCAAAA
TGTCCTGAAATGGTGACCCCGATTCCTTAGCCGGAAGAATCACCATCTGG
GCTGACACACATATTCGCCAACGTAACGCAAGTGGAGAGTAACGCAAGGA
GTTCGGACCATGTGCATACGAAATGGCCAAACCTAACCATACCAAAAACC
GAACTACATACAAACCATACCGAGCCCCAGCGAAACTGAGGCACTCCTCG
GAATCATTGTGCACACCTTTTATACGCTTGGCTTTCTAAGAATAATGTGA
ATACACGCACCACGTAACCTGAGAGCCCTAAGTATGGTTTCTGCCCTATG
CTTAAACTTCAATGTATGCCATGTACCTTCCACCCCCCTTCGATTCTCCC
CCCCCCCCTTCTCACCTCTTTTTGGTGTCTCTTTTTCAGTGAGTCTCTAC
CTCTCGGGGCTCTTTTTATAATTATTTATTTATTGTGCAACTTCCAACAC
CTTCCAGAGACAAGTCAAAGCTTTGCTGTCCGCTGCGTCCCGCTTTTTCC
ATCCGGGGAATATACTCGTACTATGTGTGTGTGTATCTTGCAGATACATT
CGATGGCCGCCGACGTGAACTAATTTTATTTGACAACCCATACTTGTGCA
AAACAAATTGCCACTGATGTGCGAAAGACCAAAACAGTTGCCACAGCTCA
GTTGTGTCTTGCTGCGTGTTGCTGCTGCTGCTGCTGCGTTGCTGTTGTGA
AATTTCCAAATCATTGCACTGCTCCAGCATGCATTTGACTAGTGCCACCA
GTTTCTTGTGCCCGGTTGGCTTTTGTTTTAAACTGTTTCGAGCCCCCGAT
TCCCGATTCCATGTCAGTTCACGGAATTCGCCCGAATCTTGCGGCTCACA
TGGAGCGTGCAGCAATAGCAGTGCCACAAGGGGCAACATTAGTAGTAAAA
TCAACTAAGAAACCAACGAACTTAACTTAAACGTTAGTGGAGATAAAACA
TTTGTAGTTCTCGTGCAAAATAAAAAAAAAAAACAATCAAACAATCGGAA
AATCAATGAATTTAAAGGCTATTTAAGTTACTTTTAAAGCTTTGGTGCTA
AAAATAATAAGACAAACCTGTATTTAAAAATTACAAAAATAATTTGCTGT
ACGTGAACAAATTAAAAAAAAAAACAATTTAAATAAAATTTTTAGGATTG
GGCATTGTAAGAATTTAATTGGATGATAATACATTTTATATGCTGCTGAC
TTTAATAAAAGTTTATATTTTAAATCCTTATTATCCTTATAATCCTTATA
CTTGTTAGAAATATAATACAATATATTATTATATAAATATAATATAATGT
AATTAGTAAACGAAAGAATGCATAGAAAGTTTCTCAGATGAATTCTGAAT
TGTATTTGGTTTTGAAAACTGAAAACTGTCAGTTATGATTTTTCATACGT
TTTCCCATTCAAAAAATATTACTAAATTTTTTTTAAATAAAACTAACTAC
TCCTTTTCTGGATGAGCACATTTTCTTTAGAAACTCATATATGATACTTT
TACTGAAACTTAAGCCTGTTAAAATTCAAATTAAAGTCGATAAAGTCATT
AAAAAGTTTTTTTGTTAAATTAGAAAGGAGCGTTTTGTTCCAATCGAACT
CGCATCAACAATAAATTAAAATGTGCCAAACAAGGCTTGTAAAATATTAT
TTATTTTAGCACTCACCTGTGGTAGCAGCCGTGGGCGAAACGGGCGTGAT
TGCCGCCGGCTGACCGACGCCTCCCGCGGAACTGCCCAGCAGTTGGAGAT
GCGACGGCAACGGCACGGCGGCCATGGGCATGATGGCGCCGGGGGATTGA
GAGCCGGCGGTGGCGGTAGCGGGAATTGCGGGTGCTGCTCCTGGCAGGGA
GACTCTAATGGCTGCAGTTGTCCTTGTGGGTCCGGGTGAGGTGCTGGTTG
CCATGCCACGCTTCCAAAAATCTTCAAGCGCCAGCAATGCAATTGATGTG
TTTGGCTATTTTTTTTTTCTCAGTGAACAACAGGCGGCATTTTGTGGGCT
TTCTGTGTTTCACCGACGGTTTTTTTGAAAGGGATTATTTGTGAAATTTT
TGTTTTTTTTTTGGCACGCCACTCGAAAACGCGCACCGAAACCGCTCGCT
TGTGTTGCTGTTGCAAGTTGCACGTTGCTGCTTCTGTTGCTGCTTCTGTT
GCGGCTGATGTTGCTGTTGCGTCGTGTTGTTGCTGCTGCTGCTGCTGCTG
CTGCTCAACGCTCGCTGACTCGACGCGCACCGCACTTCGCACTCAAACTC
AACGCCCGCCGACTCGCTGAATGAGACTGAACTCGGAGCCACCGGCAGCG
CAATATCTTACTTGGCCAAAACCTGGATCGGGTTGCTATAGCTGTTGTGT
TGCTGCATTCTGGTTTGCCTGTGCTTGTGGTCGGTTTGCCACTGAGCATT
CAGCCGTGTTTTTTTTTTCCGCCTCTGAGTGTGTGTGTGTGTGTGGGGGG
GTGCGTTAGTGTGTGTGTGCTCGCTTTGAGCGTCGCCCCATTGAGCAGTT
TGCTGAGGAAATGAGAGGCAAAATCGGAGGTGGAAAAAAATATGCCGAGA
AAAGCGTAGCAGTTGTAAAAGTTCAATAATTAATTACTCGGGCATTCGAT
TTCAGTGCATTGTTTATCAAAAACTTTCTGGCCCGAACTGCGCTACCAGT
TGCTTTCGGCCTTTTAATTGAGCGGCGTTTTTGTTTGGTAATACATACGT
GGTGTTGGCCAGTTGGAAAAGTTGTTATATGGAAATGCCGACACCACGAA
TCGGCTGTCAATCATCGATCACCAAAGGAAGCACTGAAAGAAACACTCAG
CTTGAGTGATTTTAGGGAAAGTAAATAAAACACAATAAGATATGATATTA
TATGATATGCTGCCTAATCCTTTAATACAATTGGAAAATTGTGTCTATAT
AAAGATGTAATATTAAGTTCTATAATAATGTGCCATTAATGTTATTACAA
TTTTTATATATATTTGTTTTCTGACTATTGTATTGATTAATTCATGAGAT
AAACATTCAAAGGGCTGTAGGCGGTAAACTATTTAATATATCATGTTTGC
ATTTAAATACGTTTATATGTGATGTGTGCAAACTATACATAACAAAAAAC
AGTTTTCTCTTTATCCCAAAATCCGATAATTTTAAATCGTTTAAATTTAA
TATGAAATGTTAAATTTTTTTGCGTGATTCCCATATCCTTGGCTCCCGTA
CACTGAACCCCTTCTTCTTCTGTTTCTTCCCCAAAATCGAGGATGAGCAA
AAAGCGCATTACACGGGACATTGGCGGACATTAGTGACTTGGCCGGACGA
GAAACCAATGAATCCACGTTGGACGCGACTCCACTCATTTTGGCCAACCA
CCGCGGTGGTTACTAGCCAAGTGGGGTGTGCAGTTTGGGTGGCAAGGAGG
TGGTAAGCAGCGACGTAACCGATTAACTAGGTGGAGAAAAAGAGAGCGAG
ATAAGGCTGCGCAGCAAAGGAGACAGAGCGAGAAGGAAAGCGCAATATGC
ATTGCGATTGCAGTGGAGTGACAGGAGCGGCACGAGGTGAAGATGGGTCG
GCTAATTGATTTATTTCGCCCACTGTTCCCCTCTCACTCCCACTTGTTCG
CTGGTTGGCTGAGTTACAGAAATCAGGAGCCGTGTAATAATGGCCGCCAA
CTTTTAAGTCTGTGTATGTACATATGCATGCATGTGTATTTGGGCCCTTT
AACGTGAAATGATTTTTGCACAGCCAGAGGTGTTGTTATTGCAACTCCCC
ACTGCAGCGGCACTTCTCTATCCCCCCTTTCTTTTCCAGTGGGTGTGACA
GAGAGGCGGCGAACGGACAACCTCCCACACTGATAATGGAAAATAATCAA
TTTTAATGGCCTATAATTTCGCAGCGCAAAATAACAATGATTCTACGGAG
ATAGAGAGGCACAAGTTTTGCCATTCAAAATGCACAGCCATGCACGCAGC
GCACATAACTTTTGCCAACGCAGGCGTACTAATTTATTTATGTTGATAGA
AGACCAGGCAAAAGTTGCTTCCACTAAAAAATATACATATATATGTATAT
ATGACAAGAAAGAAAAAAAACAGATTAAAAGAGAGGGAGATCGCGTTGAG
CTCGACTCACCTTCACCTTACATAATTTGAGACAAACTCAAGTTAGCTGG
CCAACTGAGTGAGAGCGAGTGAGAGGCGTGTCTGAAGAGCAGACGCGCAG
CTGCGCACTAGCTATAGAGTTGTCTTTCTTGCTCCCTTGGTAACTGGAAT
ACCTAGTTATGCCCAATGGGAGAACACTAAGAAAACTCAAAGAAAGGCAA
AGTGCCAGTGATTGTCAGAAGGGGGGGCTGAAAGGGGGCCTAGTGTTGAT
CGGATGTTAAGCAGCGGAATTAACTCGCGCTGCCCAGCCCCTCCACTTCC
CCCTTCTGATTGATTTCGGCCTGCATGATTGATTAGATTAATAACGCGGC
TAATTAAACATTTATCACTGTATCTAACAAACCGCCCGAGGGGGCGCAAA
TTAACCCTCCAAGACAACACAAATTATGCCTTCTGCTACAGGCCAACTTC
TTTGAATACAACCTTGTTAATTTATTAATTTAAATCAGATAATATTTGTA
AATTTAATGCACAAATTATAAAAGTTAGTAAGTATCCCAATAACTTTTTA
ATAAATGTATAATAAATTTAGTGCATTTACCTTGTTTAACATAAATACTA
ATGTTAAGATAGGATTTTCATTCAACAACAGTAAAACCATTTAAATTTTG
TTTTGAAGAAAAAAGTAATTCATTCAATCATATCTATTTAGCCTATCTTT
AATATAATATCTCTAGTTTTTGGTAGTAAGAATCTCGACCACGAACAAAT
AAAAGAAAAGCATTGTCTCAAAAAAACCTTCAAAATTAGTTGAAAAATCA
TGTTTTATATTAAATTTATAGTTTATATAATAAATGGAAATTCGGTTTAA
GGGCGTTCGACTGTGTGCGACTATGTGCCTGCTTCTAATTGCGTTTCGTG
CAACTTTTTCGGGGATGGGCGCATTAATTATGGCCGCCTTGGCTAACGCC
TGCCGGCCGCCATTATTTCGGCAGCAAAGTGGCCAAGTTCCAGCCAGATA
GCCATCTAGTATCTACATCCCAGCCCAAAGTTACCCAAAACTAAGAGCCC
AGCCCCGTGTGCCGTGCATATTTGTGGTAGCCACGCTTCCTGTTTTTGTT
TGCTCGCCTGTCCGTTTGCCCGCCGTCCGTTTGTCCGTATGTCCGTTGTC
CGGCTGAAAATATTCCAAACAATGTAGACAAGAAGTGCTCAGGCCGGGCG
GAGTTTTTGTGGCCATGGTTAGCGACGCGGTGGTGTTTACCCACATGTAG
GCATATGCATATGCTGATTTCCACCAAGGCGGGGGTCATAGTCTTTTTTC
TTTTTTTGAGGGGGGTTTGTGGTGGAGGAGTGGGCCGTCAGCTTGGTGAA
CCGTGAAAAACCCTGGGGTAGAACACTCCTCCAACCCAAACAGAGAAAGA
GAATTTCGTAATGTTAACAAACAAATAGAAAATAACTTTTAGGCACAGCT
CTGTAGCTTCCTCATAGAGAAAAACCTTTCGCTGGAGGTTCTACACACAA
AGAGAAAACTATTACAATCCATAAGATACGAAAATCTTTTATATATGCCT
GAATTATTGAGCTATCTTTACTCGCTTGAAACTTAGCCTTTTAAATACCA
ACGGAATGCTATGAATAAACATCTTACCCTGATAATATCTCAATATAATA
GAAGGTAACTTCGGAATAAGAAATCTTAGAATTTGTTTCTTCAGTAGTAA
AACATTTTTTTTTCTCAGCGCAAGACCTTCTTTCTAGATACGAAATCCAG
CGGAAATATGCTCAAGTTTCTGTTTTTGTTGGTCGGAAATGTTTAGCGCT
TGCTCAGAATGATTAAAGTGTCGCTTTTTGTCTAGTTCCATTTGCTTTTT
CCCATTTGCATACAAATGTTCCTCAAAATTTCGCTGAGTAATGCGAAAGC
AACCAAATCTACTTCATTGTAGGTTAAATTGCAACGACTTCCTGATTCTT
CTTAAAAGTTGGTGTAACCGCGAATTAGATTTTGGAATGTCATTAACTCT
TATAAAAAAGGTATCTTTATATAATATACTATATGAATCTTAGATTAATA
TTCATTATTTTGTAACATTCTCTGATTTAGTTATGATGGCGTTATAATCC
CTTAATCCATTTCTCAGCTCCGTCACTCAGATTTCGATACTAAAATCGGC
GGGCGTCTGAGTCATGTGCTCCTCCTTCGATATCACGGCGAGCACGCACC
ACTCGGCCGGCGGAATGTAATGATTAACTCTTCGCAGTTGCTAAATTAAG
TGAGTTTTTACTGCTCCCCACGAAATGGGATGGGAAGGGGGGAGGCACAA
GGTGTTTGGGGAGTGTCGCCGAGCAGGGAATACTGACTGCATCATCGACT
GGAGTCAACTTGCAGTTGGCCAGCTGAATACTGAGTGGGTTAAGGGGGGA
GAGCGGAAGATCACATTGCGTGTCTGGGGCCAGAAATGATTTCCACATAC
CACAGCAGTTAAAGCCCTTAAGTCAGGGAGAAAATCCAATTAAATTCGGT
AGCGAAAGAAATAAGTCTGAACTGTCGGCAAAATGATTCTACATACACGT
ATTTGCGTCAACATTGATTTCGCAGCAAACAGAAACATCCAAACAGGGAT
TCGCTCTGCTCGGACTCCTCGCCGGATTCGGGGGCCAGTGCGGACACTGA
GCGGATCCAAGACAAAGACGCTCCAAGACGAATGTAGTTCATGTGCATGG
CGATGGCGTGATTGAGGACGAACCCGAGGACAGCGGCACCAGCAGCAACT
TCAGCAAAAACGGGAGCAGCGGCAACATCAGCAGCGGTAGCAATAGTACA
CATAGAAAAAATACTACACATTCATTTGGGCAATTAAAACATTAATGAGT
TACGTAACTGTCATTTTATAAAAATTAGTTTACATTACATATCATTATAA
AAAAATTTAGCTATATGCTCTATAGGGTTTTATTGCATAATATATACTCC
AATCTTGCTTTCAGCTAAATCATAAAAAGTTACATTGCACTAGTATCCTT
ATAATTCCTTAATTTTTCACCGTGCAACATCAACATTAGCCACATGAGGC
AGCCACTTGAGTTCTTCGGTTGCTGCAGTTTGGTGAGGCGTGATTTGGGC
TTAGGCGTCTGCCCGAACTCGCATTCGATTTGGCTCTCTCAGTTTAAGTT
TGAGTTGTTACAAAATCCTGGCCGCAGACCGCAAAACCGTCCAAAAGTTG
CGTGCCCATAGGTCTTCTGTGTAATTGCGCAACAATTGTCAGGAGCTATA
GCTGGCCTCCGCTGGCCCCGATTTCCGTCGATTCGCTCCTGAATGAGGCT
CCTTAAGTAGCAGTTGGCGCTGTTTGTGCCCCCTTTCGGTTGCCTCTTTT
AAGGGCAGAAACCGCAATCAAGACACGGACACGTCATGCAGCTCAAAAAA
CTACAGAAAATCTCGAGAGAGAGAGAGAAAAAAAGGCATGTATATGTATA
ATACTCCTCCAGCTAAGTCGATTGTGCCGACTACCTTCGTGTCTGCGTCA
AACTTGCGGAAATCTGATTTTAAAATTATTAACAACATGCAATGGCTAAA
TAGTTTTGCATTCGATAACAAAAGCCGCTCCTCCAGAGCCAGTTTCGAAA
AAAAAAACGTATCCAAACTGCATGGCCTGAAATGTTGGAAAAATGCTAAG
AAATGGGGGAAAATATTCGTGTTTAGTGACCGCATCATATAATTCACGAA
TTCAAATGCAAACCATCGAATGGCTAGCGAACCGTTATAGGGTTAATTAA
ATGCAGATACAGTAGCTCTCGTTTCCACGACGGTTTCTCCACATTTCCAA
GCTCCAAGCTCGGAGCTCCAAACTCCAAACGCCAAACTCCAAGTTCCAAG
CTACAAGCTCCAATGCAGCTGCAATTAGAAGTTGCACAAAAAGCGCAATA
GGAAAAACACAACACAAACGGGGGAAAACTGAAAATGAAAAACATGGAAA
ACAAAATGGCGATAACTACCGCAATTTGCATATAAATGGACGTAGAAACG
TCTTTAGTCACCCGAATCTTGAGCAAACCATAGGAGCGATTAACATTGTT
GTCGACCGTCTGGAGTAGGGGCAATGGTGCAGGGGGCGTGGGAGGCAGAG
GCGCCACAGGGGGCAGCTCGCAACTCGCAACGTCGCAGCCAAGTGCAGTG
GCAACGGTAGCAACAGCAAAATCGCAACAAAATGGCGGAACAGCCGACAG
AGCGTGGCACCAACACCAGCCTGGATTCCCAACCCAAACACCACCCCCCA
TGGAAACCGACATTCCACTCCCCACTTCAACACCAACACCAAAACCAAGC
CAAAACCAACACCCCACCATGGGCAATGGTAATGGTGATGGTGATGGTAA
TGGTGGTGCCATCAAGCGTGTTGGCTCGGTGGGCAAGGGACTCCTACTTC
TGCTACCAATACTACTACTACTACTGCTGCTGCCAAGCAGATGGCCTCGA
CCTCCTAGTACAGTGAGAGAAATCAAAACAAGAAGAAAGTAAGTGACATG
GTAAATGGAAAGTAGATGATATGGATGGTAATGCAAGGATATAAGGATAA
TAAGGATTTCATTCTTCTTGTCAGTTGCAATGTTACGTGCATACATTTTC
CTAATATTACTTTCTATGCAATAATCTAATCTAAAGGTACAGTGTATCTT
TTTAGCTGATGGTGCTCCCAAACCTCTTTAAAGCCCTTTTGCCACTGTCT
TGAGGCGAAGCGACCAACTCTCGTATGGTTTGATAATTGCGATTGTTTTT
GTTCGAGTGGCGGGGCATTGGCTGCAGAAACGCGACCACCCGCGTCCCCC
ACCACCGACTGCCGCCACCTAGCACCAGTCCCCCCTCCGCCACTGCCACC
CACTACCACCCACTTCCTTCCACAGCCCACCCACTCCCAGCACACAGGCC
AGCTCATAGCCAGCATTGATATCACCCATTGTGCCGCCGGCACGGCTGTT
ATTATGCAAATGCCATTCACAGGTAATTACCACGCTGCACCGTTATAATT
GCACTCGAAGCCCAGCTAGAAATCGCGATTGCAGTTCGCAGTTTTCAGCT
TTTCACCGTTTCAGCTTTCCGAAATGGGGGAAAAAACCAAAAAAAAAAAA
AACAAACGGTGGAAAATCGAAGCCGCCAACAAGATGTTGCTGCCACTAAT
TGCGGTAGCTAGCTGCTCAGTTGAGACTCCCTTTGGCAGCCCAATCCGCA
CATCGCACATCGCAGATGCGAAATCCACCCGACTTGGCTATTTCGAAACT
CCGTTTAAATGGCAGACACAAGCCGACACGATTGTGGCTTTTACAATCTT
TTAAAGACTTACAATGGCCACTTATTGCAAATCTATACGAACGCCAGGCC
TAGGCCAAAATTACTTTTTCCGGCAAGAAAAAGGTCATTTAAATAAAGAA
AACTTATTAGTCAAATATTGGGCATACATTTCTTTTGCCATAAATGTGTT
GCTTTGCCATTAAAACGATGAGTTAGGCACAAGTTCGATTTTCTTGGAAT
TTTACTTTCACTTTCCATAAGCTGATAAGGCTGCAATCATTAGTTGATTG
TACTATAACAACATAAAACATACAAAGTTGAACAATTACCTTTAGTTGCC
TACATTAAAATGGCATTCATTGTTTAACTAGCTAGCTGTCTTTGAAGGTC
CACAAAACACCTAAATTTGTATATTTTTTTTTAGAGACATGTTCCATCGA
TTTGGTTTTCCCATAAATTGATAAGGTGTGTTGGATTTGAATAAATTGGT
CATATTTAGGTGGCCGTTGCAATGGCACCGCCACAGATGCTTATCTCTAA
CCTGACCTGTTACCTGAATGCAGTTTCAGCACCTGGGGGCATCTCGGCAC
CCTGGATCCAATGGGACACATTTGTGCCGCTGACACTTCTTGAGGCATCT
TGGACTGAGCCAGTGGAGCAACATCTGCAGCGGCGGGCAAATTAGAATAA
CTTAAAGACACGGCGGCACGCATTAAAATCGACTGCAGGCGATGCAATCT
GCGGAATCGGCATCTTCAGCTCCTTTCGATTTCTGTTGGCTGGTCAGTTG
AGTTCGATTCGGTTCAATGGGGTGGGGTGTGTTGTTCTTTTGATTTTGTT
TTACTGACTTTTTACGCGCGAATCCCTTACACTCTTCTGCTCGACTCTCG
CCCGCTATCAAAAAGTAATAAATCTGCCGCTGATCCATCGTAAATCTTTG
CGTTCCCTTCATGATTTACCCACATAAATCAAAATTATCGAGCCTCCAGA
CTCCGGCGAGCAGTATGATGCCCTTACTTTTTATTCCGTTTCTGAAGCCC
CAAGAATGGGGAATTGGGGGTATTGGGTATTGGGCGTTAAGAACTTGGCC
TGTTAACTGCTCGAAAGTGTTAAATGCATTCAATCTGCGAACTTGTCGCG
ACTGATTGGGCAGTTTGCGTTGAGTTCGAGTCCCGGGAATCATCATACAT
ACTCCATTAGCTCGGTTTTGTGGACAAATCTTGGGCTTGGATTATGGCGA
GTCTTTTGGTTATTGCATTTAGTGCCTCAATTATCACCCCAAAGAATTTC
CAGCTGTCGGTTCAATCAAACGGATCACCCAGCCACAAACCAAGATACCA
CAAAGTTTGGATGGTATTGTGGGATACATACATATATACAGTATCTGCTC
ACGCACCTCTCTCGCCGAAAGAAAATTCGTCACATGCTAAGTTAAATTAC
CTGTAGGGCTAATTTCATTTAATTTTCGGCCACTCAGCCATAGAAAAATG
AAAGAAGATGCGGAGCGAGCGCTACAATTACAGCATATTTTCCCCAATTA
ATAATTAATAATTTGTTTGGGTCACGAACGGTTCATCGTGGCTCTGTGAA
CTGGAGGGCAACAGTTTGTACACATATGTATATTTTTTGGATATATGTAT
ATTTTTTTGTTTTTAGTGAAAGAAGCCAGGAGGAAAGGAAAGGCGACCTG
ACCCGCCTCCAGACGGAACAATCCGGCTGACTGAGACGCTTAATTGCTGT
CACAAAAGACGGGCTCGGAATCGGAATTATGGAAGTGGAGTGGGAAGGGG
TTGTGGCACTGGGTACTGGAGTGCAGGTGAAAATCTTTTGTGGCCAAGAA
GACAAAGACCCACCTGGTGGAACACGCAAGGCCAGTCAGAGGTGCAGAAC
ACATTTTGTGTGCGATCTCCGTTTCCTTTCCGTGAACTTCTTCGTGACCC
CCGACATGGCTTATTCATCCGTCAGTTGGCTGACATCGAATCTGAGCGAT
TTCCTTCTTGGCCAGATTTCACCGCTCCGTCATCTGTTGCTGCATGGGAA
AACCTGTAGAACCTATACACTTATTGGATTTAATTATAGCTATTTAGGCA
TTAATACCTATGTGATTTTAAATTCTAAAGGGATTTTTAAAAGTTACTGC
CTTGAATACATGTTTAAATGTTGAAGGTCTTAGAACCTGGTTTAGTTTTA
GAAGAACACATTACCCATTGATTTAATTTTTCTTACAATTTTGTTCCCTG
TGCTTTCTTCCGCGATTTTCCCCCCTTTTCGACTGATTTTGCTCCAATTC
AGCCTCAATTTGTGCCTTGCGCATAGCCATAAATTAATTGATGCCCTGGT
CAGCTAGCTGAGTGATAACCATCGCTTCCTCTCGATCCATCGCTCCCCGA
TTCCCACTCCACGTTCCAAATCTTGTTCCACCATAACATCCCCCTTGCAT
TTGAGCTTCGGGGAAAAACTGTGCGCAGCTTCCCTGATTCTGCGGCCAAT
AGAGACATCACCATCGGCGTTAAACCCATCGCCTGATCCCTTTTCCCTTT
GCCTTTTCCCCGAACGCACTTTTCCCACTCTGGCCGAACCACTTGAGTTA
TGTGTGTCTCGGGCTGTGAATGAAGCGATGTGCGACCAGGATTGGCTAAT
GTACTGGATTCGGTCTGTGTCCGCTCCGTGGCTGCCACTGCCCACTCAGT
CGGCTGATCCCATCCCATCTCATCCAGAACCATCTCGCCACAGCTCGTCC
CCCTGGTCCGTATCATCAAAATTGTCGTTGGCTCGCAGTTAAATTAAGTC
ATAAATTCAGTATTTATCTGCTGAATGTAGTTTGTTGTCCGGTCATCACT
TCAGCGTCAGCCTTTGTCGCCGCTGCCCAACCAAAAGCCGGTCGTCCCTC
GCACAGTGGTTGCGATCTGAGTTTGCAAATGGGAAAATCAAACCATATAG
TTTGTTCTATTCCACTCAACTTCTAATTTTGGGTAAAAACTTCTGAATTT
CGATGTCTTCTCAATTTTGGTTAAAGATGTACCATCAGCATGAAATTATT
AATTATTATTCAAACATATGTATGCATAAGCCCAAGTTATACAATGTTAT
ATAAATTGTGTGATTCATTGTGAATCTGTCCCACTGTGCAGTGGCTCGTG
AAAGCCGCTCTTATCCAGGTTGCTGTTACTGCTTTTATGGCAGCAGATAG
CTCGCATGTGTCACCCGGCGCGGCGCCCCCTTTCAATCCACTCGCCTCCT
TGGCTTTTTCAGCATCTTTCGATCCAGATCCTCGATCGAGCTGGACATTG
GCATTGGTTCCGTTCCGTTTCCAAATCCAATCCGAACCGATCCAAGCCCA
TCCGATTCGCTCCGTTCCGGGGCAGCGGCTTAGCCCCACTTAACCGGCAT
CTTGGGGCGTTGCGAGTAATTGGATTGAGTTGGCTTCTCTCCATCGAAGA
GCCTCATTCGCACTGCCAAAATATGTGAAAACATGGCCCCATGGGAACCA
CTCACACTCGCTCGCACTCCGAACTTCAGATTTATTGGCGCACATCAATT
AGCTGACACTCGGTATCCCAGGATATCGAATCAAATACCGCCGGCAGCCA
AAGTGGCACAAATCATTGATAATGCAGATCAATACCGACCTGTCGCCAAT
TAGTCACTCTTTGTCACTCGTGACGCACTGCATCAGGAAATCTAGAAATG
GGAATGAGAATGAGAATCAATACCTTGGTCTATTTGCCTGTTTACTATTT
GGCTATTGTCCTGCAGGCCATTTATTGAAACATGATGCGTATAACGCATT
ATGGTTATTTTTAAATGTCAGCCCAGATTGGCTATGGATCGGCAGTACTC
TACTCACCTGTATGCCACTGGGAGTCGCACAGTTGCAGGTAACCGAGTGG
TCGGCAATTGTCATTGTCGTTGTCGCTGTCACCAGTGGATATTATTATTA
TTATTATGGCATATTGCCGCCGTGTGACAGCCAGTCGAGATAGAGAGACA
GATTCCCGATGACACCGAGTCTCGCACAATCCGGCCAAAAACCCAACTCC
ATCTCACGTGCGCCCCTTACCATATCTTTTTTTGGGTTTCTCTCTCTTTT
TATTTTTTTTTTACTCCTCTGGCGGCAGCGTGAAATATTTTGACAAATCG
CAGGCCACTTAATCAAAAATCATCAGCAACGCAAAGGGATCGATGTTTTG
TATTGAGGTATCATGGCATCGTGGTAAGAAGGTATCAAGGTATCTGGGTA
TCTGGGCGCATAAAGGACGAGCCGGCGGCGGTGCCTGTGTGGGTTGAACA
AGAGATTTCCGTCGAAGCCGATAAAAGGTTATGAACGACAGCCCGCTGGG
GTGCACGATGCACTGCGGGAAAAGTTGTCGACTAATATCAAGGCATATTA
AAATTATAAACAAATGAGTAAGATTTTGAAAATAACATCCAGATCATTTA
AATGAACTCTTAAGTGATTATAATCCATCCATAAAATGACAGTTTAAGTT
ACAAGGACAATAAGTAAGAATAAATAAACTTTAATATCTTATAAATATGT
AAGACCATTTATTTACTTAGCTTTAAATACACCTTATTTGAGCACCCCTT
TTCTCCCAGTGTGAATACACAAATTTGGAAGCTTCGCAGTGCCGCAGTGT
GTCGCACTTGTCGCCTGCCTAGAGGTGAAAATTATGAGTATGGAAGTGGG
AATGGGTATGGGAAAGCCTCTCATACACACACGTTTTCCGTAATGACTGT
TCATTTGTGTTAACACGTGATTAGAGCCCGAATCAATCTTAATAATGAGC
AACGTGACATCGCAGGGGGTTACATCCACGGATAACTATCTGTTAAATTA
TAGATTGCTGTGGTAGCTAACCGATTGAAGTCGCGCGCATCTGACTGCCT
CATATATTCATATATCCATGTATCCATGTATCCATGTATATATGTGGCAT
CGCCTCGGGGCGATCAGCCATATAAATGGCCAAACATTTATCAATAAAGT
GCGACGTGACCAATTAACCGTTTCTCGAGTCAATAAAACGCATCATTAAA
AGTGTTTGCCTAGCAGACAAGTCCTCGGTTAAACAAGATGAGACACACAT
CCCCATTCATTGGCATCCTTGGATAATGATAGCCGAATAAAAAATCAGCC
ATTGAAAACATTGCATTGACATAAACAGGTGATAGATGCATACACATCAA
AATCTGTTTTTTTTTTATTGTGCGGCAATAATTATAAATGCTTTGCGAGC
AGGTGTGCACTGAAAAAGAAGTCTTTACTTTGTAAAAGATTTGAAAGATT
CAAATGTGATATAGAAAATAAAGAAAGGTAAAGAATAAGCCATTAAATAA
ATAAAAACACATGAAATTAATAAGATGTATGTAGAGTATCTAGACTAGTT
TACAGATACAAAATCTAGCATATTGAAATTTAATTTCTATATTTAAGAAA
GGATTTATTTCTTACCGAAAGCACGGAATTACATGATTTTTTTAATAATA
ATAGTTCAACTTGATAATTTTTATTAAACTATATGATGATTCTGAACATT
AATGATCTAAGACATTTCCATATCCGCTCTGAATATTCAGTCCAAGCACA
CGCACATTAGAATACTTATGATGTACCTGCCCATATCGGGGTGCTCCAAT
TCACTGGCTCCGATTCGGATGGCGTACTCCAGATGCTGCGATCGACTGAG
TCCGTAATTAAAGTCGATCGATCAGGAAACAAATGCTAAAATCACGCAAC
TCCGAGTGAGCCAAATGCGGCGGCGGCGGCGGCGGCGGCAGCTGAAGGAG
CACGAACTGCGAAAGGTCGATTGCGATTGCTTCATCCGACAGCCAGGTGA
TGAGCCATCATGCGAGGCCAGTTCTCTTGTATGGACAGATACCTGTATTA
GAGCATCGATGAGAAGTCCAATCGATGAATTGGTGAACTGGTGTATCCAG
CGATCTGACGATCCGAGGATCGAACTTGATGGGCGCGCACGCGATTGATT
AAAAAACCACCGCGGAGTTTGTTTGAAAGTGTGGGCTAATTTTCATAGAC
AGCGCACGCTGGACACGCGCATGATGCGTATCTGGGATCTCTGGGCTACC
CGACATCTACATCCCATCTACACATGGTCACTTTGGGTGCAGAACCCAGA
GGAGCTGTCTTGTCGTGCGTCAAAGGATGAAACTCACCTGTCTGCTCATC
GGCATTTCCGCCGGCTACTCCACAAAAAAATGCAGAAGCTATAAGAACTC
ACAACAAAAAAAAATCGAATGTTTGCATCATTATCGAGAACATTTTTGTC
CAAATTTATTCCATATTCAACGAGTCCTTGCACACATTGCTCTAATTTTT
TCCGCTGCTTATCGTCCTTTTTGTTTTAATCACCGAGTGCCCTGGACCCC
GTTTCACCTTGTGATGTGAGTAGACCCTGTTTTGATGAATTGATGATGGG
GTCTGGATGCGTTGGAAAAACGCCTAGCGAACGACGAACCCTTTTTGGTT
TTTCTTAATTTGGAATTTATTTAAATCCACAATGATCGGCGGAAAGGACA
GGGGCATACTGCAGTCAGTCAGTCAGTGAGTGGTTCGAGGTGGTTCGTCG
CCCCCGTTCCGATGTGGCAGGTGCAGTTGCAGTGCTGCTCCTCCGATCGG
TGGCATCATCATTGCGATGACCCTTTTTCTGCCGCGATGCTAATGCATAA
ATAACACGTTCCCGGCTCTTTTAGTTCTTGGCTGTGAACTCCCAGCCCTT
TTGGCTGCCAGCTACTGCCATTACAGCGGCCACTCACCGAAAATTTTTAA
AAGGCGTTTAGCTTGTTACCTTTTAATAATACCATTTAATTCCCCGTTGT
TGCGGCGTAGGCGCGGAACCATCAATCAGACCGTGCAGATAGCGCCGCAT
TCGAGGACCGGACACAGTGCTCTCCCCTCCACTGCTCTCCTCTCCACTCC
TCTTGGCCGGCAATTCATAATTTATTTGCGTTTTTGTCCATCACGTTAGC
TTCATTTTTTAGCCCGTCACTCGCCGATGGACAGCTGAAGATGCCTGGCT
GGTGAGGAAGCCCCCTCCATCCTTAGTTCTCCACTCCGAACTCCTTCTTC
TCGGGAAAAATTGAGTGGCGGGAATGTGATCGTGTCCCCAGAGATGTCAA
TCTATAGATGGCTTCATCGAACACCTATCTATTCTGTTCATATTGAAGCA
TACTAAACTTATTTATAATAAATTTTCATATTAGCTTGAAATAGCTTGAC
TCCTTAGTAGTTCACTGGTTTATGACCCATGAAAGTGGGCAGATTGAACA
TTATCCATTAATGACCACCACCAGTGGGGTTGGCAAAAGTGGTTACATTC
AGCAACCCTTTGGCATTGGCACCACAAATTCCAGTGGACATTGCAATGCC
AACATGAACATGGCCGACTGACGCACGCTAATGGGCGTCACCCGAATCCG
CTCCCAACTCACGCAGAAACCCCAACAACTCTATGGATATGAATATATAT
GGAACACCCCTCAGTGCTCGAAAAATCCATGGGGTGAGTGGGTGCCGCCA
AGTGGCTACTGGCCGGCAGTAGCCATCCATCCATCCATCCACTCATTCAT
CCACATCCACATCCACATCCACAACCACATCCACGACCATCCAGAAGGGG
GTGTTTGTGGTCTGCTATTTTGACGTGGCTGGCAGGCCAGCTGGCCAGGC
TAATTTACGAATAAATTATGTGACACTATGCGGGCGGAGTGGTTGCAATT
CGACGGCCATTAAAATCGCCAATCACCGGTAGTCAATACCGGCTATTTGC
GTTCGCAATCGGTGTTGCAGTGAAAGGCGGCGGGTGAGCATCGTCCAAAA
CAGAATTGCACTGGAAGAAATTAGGCACAACATTAGAGCGATATGAATCT
GAACAGATTAAAGCACAATGAATATATCAATTGTTTTAAGATTTAACATG
ATTAACTATATTTATTAAAAATGCAAAGAAAGAAATTATGAAAGACTGAC
TTCTTTCTCTTATCTAAACTATTCATTAGAAGACCCATTATTTGTAACCA
AAAAAATCCTTAAAAATAATTCATGTACCTAACACATTCTGATTGCTTTG
TAAACATTTTTTGCCAGTGTATGGATCCAAATTGAATAATGCAGAGCAGT
GTCAGGGTTCGAGAGCTTACAGGAAACCGAAGACGCAAATTGCAGGGTAG
CGCCATTTCAGGCGAAAGATCGGCGGGCGGATGAGGATCTTTTGGAGCTG
CAATGCTGGGGTCTGCAATTGGATCAGGATCAGGGAATAGGTTCAAAGAT
TGGGGGAGGGGTGTGGAACTGAAGTCTGCGTCTGCAGCTTTTTGTGTTTA
TGAAGTTGTGGATTTTTCGCCGGTTTAATTTTCGAGCTGACTGCAATTAC
AAGCCGTAAATTTGTCATGGCGCGATAAATTGGTTGTGGATGGAGCTGGG
ATCTGAGCGGGATCGGGTCGCGGGCGAAGTGGGGTGGAGTGCCCAGACAG
CCTGGGCAGCCTAATGCATGTAATCTGCCACTCAACACCCTGCCAGATCG
TCCGGTCCGTGGTCCCGGATTGAGATTGGTATTAAGTCTGGACTCGGCGC
TTGTTAACCAATTTGGCACGCCTGCGCAATGGGATGTTGGAATCTGGAAT
ATGGGATTTGAGATGTATTATCAACGTTGGATGGATGCATTGGATGGTCA
GCCATTTTATGGCCCATAATCAGCAACAAACTAAATAGGAGTCCCCGGAA
TAATCGCCGCTGGCCAATTCAAGCTCACATTTTGGCCTGGTTAATTAAAT
ACGGATTTCGCTTTAATGGCCGATAAAACTTGATGAGAAATTTTAATGGC
GCGCCGCGAGGCGATCGCTTCAGGATCGCTAAATCACCGTTAAAGCGATA
ACGCCCTATTGCAACCATCCAACCAGCCAACACAAACCATAGTCCGTAGT
CCGTAGTCCGTTGTCCGTCGAAATAGCCATTTTACGATCCAATTGCCAGC
GAAATCCCACTTTCAATGCCATTCTACGATCCTGGTTCCCCACTTACTTT
GTTGCCGAGGCGCACAAAATTAACTGCTGATGAATGGCGACGCTGGCAAG
GCACTGGCAAAAATCTATATTTCAGTCTCTAAAGATTTTGAAATTATTTA
TTATTTAATAACCGAAACATATATATACTATTTAAGTGAAATTATATCAA
CAAACTGCAATTAATTCCCCCTTAACGCAGCGAAAGATTAAACAAAGTGA
AATTCTCCATTCATTCATTCATTTGTTTATCAGCTTACGAGTCTAACAAC
AATTAGTTTTTGTACTTAAAAATGTTATAAATATTTTCTGTAATTTTTCC
CATTTCATCTGTACATTTGCACACAAAAGTCGACCCAGTAGGATGCACGT
AGACATAATGCCCCATCCATCCAATCGGGTGCTCTGGTTCAAAGTCACCA
AGTCACTGACAAAAATGTTGTAAGCCGCTCTTAACCAGCCGACTGTTGTG
CGATTTTTTTTAATGCCTCCGCCCGCGGTCGATGTTGCACTTTCTGCTGC
TTTTGCTGCAGCGGCTTACAAGTTGCAGTCGCAGAATGGGGCATTCGTCC
GCCGGACGGGGCATAAAATTAAAATGTTGCACGCTCCACCATCCGGGTAC
GAATGTGTTTGAGTGTCTGAGTATGAGTGTTGGTGTCTTCGAGTCTTTTG
GCGACCCGGCGCGCTCATTAAAAACGCCATAAATGCAATAAAACGTAGAG
CAAACATCGATTAAACAATATTTATGGGGCTTCACTTGCACATTGTTCGC
TGGCTACGCGCCCTACGGCTTTTGCCAGCGGCTTCTACGTGGACACGGCT
GCGATTCCGATGCCACTGCTATTCACACTTTTTGTCCAGCTCTTGCCACC
GATCCATCCGACTGGTAACCCGGCCAAATCCGGCCCAAGCTGGCCAGGTT
CTCGGTGCTGCTTTTTGCCTCCATTCAGACCCCATTTCACAGCTATTGCC
ACACATTTGTCACATCTTCATGCGCCACCAACTTGGCCGGAAGCCCATGT
TGTGAAGGACTTTTGCTTAAGCCGGTGCTTACATGACTCGGAATTACCTT
TTTGGATTTTAAACAAAATTGTATTATGTTGGAAAAATTGAAATAATTAT
TTTAGATATAAGCTGTAGAATTAAACATGTCTAAGGTGATTGGATTGCGA
GATTGAACGGAGTTCTCTTAAGGGAAACATTTAATGGAAAATAAGTTAAA
ATTTTAGGATTTATCAGTATTTAGTGTTAAAATACAAATAAAATATGCAA
ACTAGTGCAACTTGGATAATATGTAAAAAACAGTTTATAATTAAAATTTA
AATTTAATTAAAATATATTACTTTAAATATTTCATATATCCTAGTCTATA
ATTTAGTGTCATCCCATAGCCAATCAATTAAGACGCAGATGTGTCACTGA
CATCTTCATTTGGAGCATCTTGTGTGCGGAAGATTATGGAAATTACTGCA
AATTAAATAAACATTTTGGATACGAAGCGGAACATATCAATTTTGGATCG
CAAAAGTGAAGATCGCAAGTGGCAGACAACTTGAGGCGAGCAAAAATATG
GGCAATTTAACGAGTCCGGATCTTGTGGTTTGGGATATTAGTGAATATTA
TCGAGGAATACTCGGAACGAGGGCAGCTGTTTTGGCCCGAAAGGTTCAAG
TGTTAAGACAATGGCAGTGCACGGCGCTCAATGAATAACAATTACAGCTA
TTAATCTTGGCTAAAACGGCTGGGCTGGTCTGCCAGTTTCGATCCGGCAG
TGTGGTTAGACATTACGTCCTGCTCCCTTTTTTATACATATATTTTTTTT
TTATATTTTGCCTGGCAATTTGAGAACCATTTATTTATTTGTTAAGTGGC
CGTAAAAGCGGTCACGGCAATACCAAATGCAAAAGGCAAAAGGCGAAAGG
CAAAAGGCAACTGCAATGGCCTTTTCTTTTTATTAATTTATACATTTTGT
ATAAGTAATAATTGTGCGGAAAACGGAAACAATGGAGGTTGTGTAATGCG
GCCCGGCCACTCAAGGCGGTAAAAGGCGTACATGGTGTGTGCGGTATTAA
AAGTGGGCGTGGCATTGCCGGACCATCTGGCGCTGGACAAGTCAGTCAGG
CAGCCTGTGGCTCAATGGAAAAGGAGTGAAAATTGCTCGTAATTACCCAG
TCACACACACGCACACGTATATGTATATACATATATCTAGATATATGGTA
TATATCTGCGTATGTGAAGTGAATGCAAATGGTAAATATGGTCATTATCT
GGTCCAAATTCGAGCACCAGGCAACCACTAACCGGCGCACAACGCCTTTG
CTAGACGAATAGCACTCGAAAGCGCGACTTGGTCCGCCATGCCGGTTGTC
CCAGAACCAGACACTCCTCCTGGCCAAAAAAAATACCCCGTGGCCATCTA
TATATATATATATATATATATGTACATATGCCCCCCTCCATGGCCGCTCA
TGTGCACAGGAAGCACTCGCGATGGCGATCAGCGCACTTACCAACGCTGC
TTACGGCCATAACCATCCGGAGTTGGCTTCCAGGGAATGGAGCACACGGT
GGACTGCCACTGCAGTAGCCATGCCATTATAATCATGCACCACAGACAGA
CGGACCTCACTTGGCCCGGCTATCTTTATTTATTGTGCCTGTCTTGCTGT
CCATAAAGTTTGGGAAGTTTCAGCGAAGGGAGGATTGGATTGGAGGGGCC
AAAAGTGCGGGAAAATTGCCAAGAAAATAATTATATTCAAACGGTAATAC
ATTTGAGACGCCGCCAAGACGAATAACCAGTAGTTAAGTTTGTCATTCGC
CGTGTTTAGGGAAAGGGTTTGGTCTACAAAGGTTATAAAACGATATATAA
GCAAACTTTGGTAGTAGAGGGTCATTCAAAGTAATAGCTATATGCTATAT
GGCTTAAAATGGGATTTTATTGGAAGAAAGTTGGTTAACTGAATACATCC
TTGACTTACTCCTTAGCGTTGCTTTCAAATTCAACATAATCTAATTAATA
TAGTCCGGAAAAGGTTACCACAAACTCTGTTCATTTAAGTGGTATCATAT
TCCCTCAATTTCGAGAGAGCATCTGCATGTAATATTTGTTATTTTAATAA
CCACTTTGCATCGGTAATGACTCCTCGAAAATTAATTCCAGAGCATTTCA
GTAGGTGTAACCCATGACCGAAAGGGTAAACCAACATCTGACCGAGTTCC
GGACTTCCAGCTCTTCTGCCCCATCCTCGATACCATACCCATTCCCATTC
CCAGGCCCTATTCCATTACAAGCCAAGCGTATAATTGAGGCAATGTCGAT
GAGGCAGTGAGTCAAGAAGTTGTGTCTCATGAAGCAACCACAAGTCACAT
GTTGACCGCAGAATAAAAACCTCTTGCGTTGGCTCTATTCGAATTCGATT
AATGGTAATGCCAGGGAAGTGGCCACAATTTAATCGTAACAATAATTTGC
ATTTCGAATTCAATAATTTGCATTCTGGAAATCAGACCTACATTGGGCTG
AGCATAAAACATTCAAAAAAGTTCCGCCCCCTCTATTTGTCTGCCTTTTC
GTTTTTTTTTTTGGTTGGGAGGTACAATGACCCAGTACCATTTCTTTCGT
TTTCGGCCAAGACCAAATAATACAAATTAAATGTTGTGGCTTAAATTGCG
GGTTACTTCGGCGGCGGGACACACTCAACTGGTCGCCAGAAATGGGTTGA
CTGACTGACTCCACGGCACGATCATTACGGGTTAAGAAGTTGTCCCAACA
AAGGCCTAATGGGTGAGTCACCCCCACAGGTTGTGGTGCCATCTTGGCCT
GGCCTGCTCCAAAATATAAAAATATAAAATATCAAGTATATCAAGCAGCA
GTATGGGCATTTTCCCATGGATATCAGGATTACGCGGATGTCATGGATTG
CGACACGGCTGATCCGCTCAACTGAACAATTTCACAATATTTGGGCAATG
CTTTTGCTTCCAGGTAAAAGCCAGCGAGCCAGGGAAAATGACAAACATGA
TTCGCATATCGCAGCGAAGATTTCAAGTTCGATTTTTGTTTTTAATTCGA
TTCGTTTCGATTCGATTCCGCCTAATCCAATTAGGATAGCCAGCCATTCC
GACGGGTGCTTCGCTGGCCAAAGCCCTAATAATACCCAAATTATGGGAAA
GCTTTTGTCCAACCCAAAAATAACAAAAAAAACAAGCAACCAGAAAAGAA
GGGAGCCGCTTTCCGCTGGGGCACATATAACATATTTAATAAACAGTGCC
CTCATCATTCAGCTTCAACTCGATCGTATATCAGTCGCATGAAGACATCA
GCGGACAGAGGAAACTTGGCGGCTTGAAAACCTGGGGTCAAAACCTGGGT
CAGCTGCCCTCCACTAACTGGTTCAATGGATTCAATGATAAAACAACGAA
CACAACTCCACAGTTGGCAGGTCACTTGAGGAATTGCAGCGCAGTACGCA
TTTAATTGAATTAAATTCCAATTCCGTTCGCCGTTTTCTCTGCCAACTAT
CGCTTTGATCAGTCAATCCAATTATTTGCAAAATTTTGTCACATAAATAA
CTAGGCGATCTTTGCGGGGAGCACTTCCTTTCGCGTATCACCTGTCGTAG
GATCGCGACCACTGAACCACTTCGCGGTGGTTCCTCGGTGGTACTTGGTG
GTGGCGGTGCTGGTCTGGTGGTGGTCACTCTTCCGTCAGCAATTGCATTC
GGTGGCCACGGAAGTTGCGCCGGCGTGCCGATTAACACACAACTCTGGCC
AAGAAACTCCCGCTGCGAAGGGGTAATCTAGATACACTCCAAAAAAACTG
CCTGAGTTGTATATTCAATATCAGATATATAAAAGTGTATGTATTTGATA
GATATATAAGGGAACCAAGAAATCTGTACTTTAGTTCTAAACGAGGATGA
TAACTCATTTTGATAAGAATTTCATATTATAAATTCCTAAATATTGTGAT
ATTTGGCCGTTTAGTTTTTGCCCCTTTTGGGTATTATTCTGGTTATTTAA
GCCTAGAACCTTTGGTTCCTTGTTTTTCCAAGTGCACACTCACTCTGCGG
TCCCCTTCCTATTTCCCATATCTTTTTGAACAGGGGTGACGAAAGAAAGG
TTACGAGTCCTGCGTGTCGGGGTGCCCAACATATCCAAGTGCCAGGCTAC
CCAACTATCCAGCCATCCAGTCATACAGCTACCGTGATCAGCGTTCGTGG
CCAGATCGCTTGAATGTTTTGTGTCGAGGTGTTAATTGAATTCGTTTTGC
ATAAGTGATGGAGGGCGACTATGTGGTGCAAGGAACCCAGGAACTAAGGA
ACTGAGGAACCGAGTAACCCGGGACCACCTGCGATCCAAAGGACACATGC
AGCGTGGTTGAGTGGCCAACATTGTGTGTTAATTGTGGCAACACACAATG
ATGACAACAGCCGCCGAAACAAAGCGGCCAACCAATTGTCAACATGACAG
CGGCAACTAGCTAGTACGTGCAACATGATGTTGCCGCTGCAGTTGCTGCA
GTTTGCTTGCCATGATCGCTATCTTCCGGCGCATATTTGCATATTCCACC
TTGATGCATCTGCATTGTTGTCGCCATCGTTTGCGTTGTCGGCTTTATTA
TGTCATTGCATCATGTTTATCGCCATCCGTCATGCACATTGTGTAGAAAT
TAGCACATAACCCAAATGTGTAAAATACCAGCGAGTAAATTAATTGCCAA
CAATTAGTAGCTCAGAAAAGGAGTAGGGGTGCCGTTGTCATTTTGCAATT
ACCTGTACAACAATCAGGTATATTGGCGCCTTACCCTTTGATATAGCCGC
TAATAGAGCTGTTAAATATGTGCCATATATCGCAAGTAAGGGGGGGGAGG
TGGGAAGGGGGGGGTCTCTGGATGGCGCTGGATCAGCCCGCTCACAGGTG
TCAGCAAATGCGACAGTCTTCGCTGACAGCAGAATGCCCTTTAATGTTTT
AATGTCGCAAGTGGCGACCCATGCAAATGTCACGTTATCCGTGTCGCGCA
TTGTCACTGCGGAAATAAAACATAAAACGCCGCACCGTCATCGCGATAAA
TCATCGGGATGGGTTCGAAATCCGTTCCATTGGACTTGGATCGTACAGCC
AAAGTGAGCCAAGAACCAGCCGCGGCCAACAGATCACTGATTCCAGATCA
CAGATGCCAGATCCCGGATCCCAGATCCCAGATCCCGAATCCCAGAAGAG
AGTTGCAGCTGTCGCCGGAAGATCGCACTCCTCACCGTTAAGTTTGCTCC
ACATATGTGACTTGGCCAGAGCTGATCGCATAAATTAGCCATTTAATTGC
CAGGGAACACTGAGAAGAAACAGAATCAAGAATCTAGCAATCTGTGCAGC
TGATTTGGCCAGCTAAAACTTAAAAGTAGTAGTAGTACTATTGATCGCAA
TTAGTCAAGCTCTTAAGTAATTGGGTTGAAAGAGACCTTGTATTTTATCA
AGGATTTAGCAATTTAGTAATGGCTCGGTAATGGTTTCAGATTTATGGTT
TTTTAATAACACTTTTTACTGCTCATGCTAAGTGACCAGTTTTCCCCCAG
TGCATCGCTGATCGCCAATCCAGCAGAATCTCGATGGAATCACGAAGCGC
AGGCGACTACGAGCATTCAACATTTGTATGCAAATTGCTCCGGTCTTCGG
GCAGCAGTCTCCGCTCCTCAGTCTTCACTCTCCGCCCCTCCCCAATCTTC
AGTCCGAGCAGTCTTTGGAAACCACCTCCAACCTGCTAGCTGCCAAGTTA
GCCATCGCTTAGGTGCAATCATAATCGACGTCATATAGTTACGGGGCGCT
ATCGTTATCACCTGGCGAACCTCTGAGGCGACTGCATCTGAATTTGTATC
TGAATCTGGGCACGCAGCTAAAATAAATTTGCATATAAATTGCCGATGTC
GAATGCCGCTGCCGTTGCCTTCGCTTCGCATTTAAAATCGATGCGCACCG
CAAGCAATTTCGGAATTTATGTAAGCATTTCGTTCGCGGCTTTAATTGAC
AGACTCGCGGTCTTGGCCAATGGCCAAGAGTAATCCAATTAGCCCAGCAG
ACATTCGGTACAAGGAAAAGCACTTGTCGCCCGGCTTGGAGGACCACTGC
GAATCTCATCTCAATCCGGACGCGCCGCATTTCCTAATGAAGATGTCTTC
GATTTGCCCGCGGCCAATCTCATTCGGGTTAACTCGTAACGCTGACGTCA
CTGGCTGGGCAATAAAAAATCTATAAATTACGAGGACATAAATAAAGGAC
TTCACACCGTTTCCGAAGGGAAGGCACACAAGTGACCAGGCGTGCACATC
CATGCGGAGATCTCTAGTGGAACTAACCCACTTAAACCCATCGTCTCAGG
ATTCTAGACAAAATGCTTATATGATCTCTAATTATTACATTTTAAAGCAA
ATTCAAAGCCAATGATCAAGCATTTACAAAAATTAAGAATGCCTTTAAAA
ACTTTTTCAAAACTGTTCATATGGATCGATTTTATAAAAGTTAAATTAAG
CTAAGTTAAGTTATACTTTCAAACGCGTTTACATTTCTATAAAAATAATA
TATATACAATTAAGATAGCTTAAGTAAGAAACCAAAGAAAATTCCGAAAA
CTAACAAGCTGTTTCAAATGGGCACATTAGGGTTAACTATTTGAGTTGGG
AACTCTTAAGATTTTCGAATTTTTTCAGCCTTGTTCGTCTCATTTGCGGC
TATTTTCAAATTCAATTTAATTCACTTTGTTCGGTGAGCATTATCAGCAG
ATAGCAGATAAATTGGGATCACTTCACGCTCCTAATGGGAACTGAATCTG
GAACTGAAACTGGGGACTGGGGACTGGGGAAAATGGGACTTAAAACAAGG
CCCGGCGAGGGGAGTGGGGCCTGATGGGACAGAAGCAGGAGTAGCCACAG
GTGATGATGATGATGATGATGGTCAACTGTGAGTCCAAAACTGTCAAGGG
AATCACGGGAACGAACGAGCGGTCAAAGAGGTGAGCACAAACAACATCAT
CGCATGGCCACAATCTCTAAGTCGGGCCCAAATGGGAGCAAGAGGAAGAG
TTCGCCAAGGTGTCGACAAGCGGACAAAACAAAAACAACGTTGAATGGAG
GAGGAGGACAAGTTGAAGGAGGAGGAGGAGGAGAAGCGGATGGGCTTGGA
ACTCTGGGCGCTTCTGCTGCCGTTGTCCACAGAGATATCACAATAAATTA
GGAAACGAAATCTTTACTAAATAAAGACATAAATTACACTCTGAATCGCT
CTATGGGCATGGAGACCGCGGCACTCGCGATCAAACTCAAACTCGAACTC
AATCCGATGCCGACCCGTTCTGAACCAAACCGAACCGAACCAACCGATCC
GATGCGATCCGAAATCGAGTTCAAATAAAAAGCAGCCATCTATGTTGAAT
GAAAATAAAATGTTGGCGCACAAAAGCCGGCGATGAGCCACAATGGTGAC
AACAACACAAGCGGCATAAAAAACGACAACCACAACGACAACATCCCAGC
CGAATCACTGAAAAAAATAATTGTTATATGATTTTTTACCAAATTATTAA
CATTCATGATCAAATATGAGAAAAAATCAAGTTGTTTATCCCTAAACAAT
GATTTACAAAACTTAATTGTACATTTTTCTATATACACTTTTATTGAAAA
AAAAACCTTTAATTATTATTTGGGAAATATTTTATTATGGGTATCAAATT
ATTTCAGCGCCTGTAGTCACTGGCAAATATTCCGATATTTCACCAACTAA
AACTAAATGTTAATTAATTTTACCAACATTTAAGCAACCTCATTCGATTT
TTCTTTTAGTGTAGAACTGAAGAAGGCTTATAAACAGCGAGAGAAATACA
AATAATCAAACGAAATGTATTTTATAGGGTGATAAGAATCAATGAAGCCA
CTGAAATCCTATAGAGACATATTGTTTGCATTATGTGGCAGCTAGTGCCG
CGCTTAAATGGATATATACTCGTACATATATATATATTCCCCAGATCGGA
GCCAACTTATCAGCCAGGTCGGTGTGGCTGGTGTGGCTCAATTAGTGGGC
GATGTAGGCGCATTAATACGTTAATGCGAACACCATACGGTGACTTCGTT
TATGGGTGATTCGCCGGAATGCGATCCTCCGATCCGCATCAACATAAAGC
TGGCTGGGATCGGATTGGATTGGATTTGGAGTGGAGAAGGGGGACTGCTG
CTCGATCGATTTCTCGGTCGGCAGCAACGGGTCTTCTGTGATTTTGGGAC
AGGCCATAAATCTTGGCCGAGAAGCCGTTTAACATTTTTGTAAGTAGTAG
TCGGCATTTCGTAGCATCTCTCTGGCCGAACAATAGGCGTAGTTTAGAGA
TCTTCGGATGACCAGGACGGGATGCGGCTGCATCTTAATCAGGTGCAGCA
GCGTCATAAGTCTCGGTTAATTGTGGCAGCCACTTCTTTTGGTTGCCTCG
TTGTATGCTGAACAGCATTAGAAGGTCGAGATTTATGCGCGGACTAAGTG
GTTCGACTCGCGGCGATTACCGCCTTTAATTAGACATTGTTTGGCTGGCC
AAGAAGTGTTCTGTTTTATGGCAAAACACTGAGCCCGCACTCAAAACATA
CTTAAATAAATTATTTAGTGTCTCAGTCAAAAATAAACAATTAAAATGTA
AAACATATGCATAAATAAATAAACGAACTAGAAATAACATTTCAACGAAT
TTCAATCTATATAAATCAATCGGACATCTAAATTTATTACAGTAAAATCA
GTTTTAAATTTAAAAAAATTGTTTATTAAGTTCAATATACTTTTAAAATA
GGTTTTTTTTTTAATTCAAAAAATACATAATAAAATATGAATAAATCTTT
AAGTTAACTACTGCATAGTTCAGATTCTAACAAAGCTAAAATTTCCTACC
ATAACAAATAAATATGTACGCATGTTGTTTTTATGGGTGTGGGGCTCTTA
ACCTTTTGACATTTGTTGTTACCAAACTTTCTGGCCCGACCGATAAACTT
TCACAACAATGCGAAAGAACGAATAATGGTTTGAAACCGAAATCCGCAGC
AACGGGAGTTGGGTAGCCCAGTGATTATAGCCCACAATCAATCAATAGTT
ATAATTGGTCATAATTCGGTAGCCGGCCGCTAATTAGATGCCTTACAATA
CAACCAATTTACCACGCGCCAATGGTTTTGGCCAAAAGGCCAGGCCAGGC
CAATAAGAGAAAACCCGCACAGCAATTTAACAAAATATGGAAGCAGATTT
ATCATATGCAAATTGCTCAGCCATAACAAAGGCCCCAGCTGCGTTTGAAT
ACGGGTTCGGTTCGGTTCGGTTCGGTTTTCAGTTTGAGCATTTGAACAAG
AATCGGATTTAGAGCCGGAGCCAAACTTAGGATCACAAGATTTGAAATAG
CATCGAATGAACTGAAAAGACATCAAAGGCCAGAAACGATCCGTGGAACA
AGAGGCTCCCAATTACCAATGGGCGCATACTAGAACAATTTCTACGGACG
CAGACTACTGGCATTGTTCCCAATTAATCCACGGGGAATGCATAAAGCCC
CCACTCGCTTTTTGGGGGCACTATCAACACCTCATTACTCTTTTGATCAC
ACGCCTCGTTAATGAAGATGTCAACGGCAGCTGCCGCCGCAGTCCAAATG
AATAAAAAACCCCAAAAAGAGCCACGAAAACGGAGACATTTGAATTCAAA
ATTCAAATCAATGTTCAGAATGCCGCCAGACTCGAGGAGGCTCCAACTTG
CGAGGCGACAAAGATTAAACATATATATGTATGTACATATGTATATGTGG
TATACCCACTCAATTAGCTGCCGGCGAAGTTGGGATACTCTACTGGGTAT
TTCAGGTGTGTGGGGATCTTGGAAAGAGTCAGCGTTGCCCGTTGGAGCAG
CGCATCCGAAACCTTAACTGAAATCGAACCGAAACCTGTATCTGCATAAA
GTTATAAAAAAAGAAAACAAATTTGTCTTATCGCCCAATTCCAAATGAGA
TGACAACGAGACAAAATCACTCTGTCCCCGCCTCGTATACCCCTTCTATA
AGTCTGGAGATCCCATACTCCTAGCGCTGCGCGTTAAAAGCTCGAGCTCA
TTTAAGGAGCGGACAAACACACAAATGCACATTTTTTGTTTTAATCGCTC
GGCTCATTAACAAACCTTTGGGATTGGGGGGTATCCGCAGAGGGATTACC
TGGGTCGGGTCATCTGAATCGCCATTGTGGCCATTTAAGTTTGGGCATAA
ATCAGTCGACTGGATGGCGACACTCTCACGCATTTCAATATCCCAACATG
TTTCACAGCCATGCCATTGGATGTACTTTCCAACATATATATATGTCAAC
TCAATTTGTTAGTAACGAAGTTTACTAAGTTGCATTAACATAGTTTAAGA
AATCATTTCATAGGAAATTAATAATTAAATGATTAGACTGTAGATTAATA
CTTAAAATTAAAAAGATGCCAACTTTTAAAATGAAGTGAGAGAAAAACAA
ATACTACAAATATTTCGAAAGTGATCTTTTGAAGATTTTGCATTATTGAT
TAGCAGCAGTTTCAGTTGACTCCTAAGCGAGTTTCTTACCCTTCATATAT
TTAGTTAGGGATTCGTGACTATATAAAAACCATAGGATATGTAATTGCTT
TTGCGTGTTTGATTGCCGAGGGGAGGAGTCTATTTTTTAGGGGAGCAGGG
AGGTGGGCCATGGAGGCCCCCTTATTTGAGGTATGTATTTGTTTTTGTTA
GCCGTAAACGTAATGGCGGAATAACGACACCCATTCCCAACTCCCATTCA
CAACCTGGGAAAGATATTCGCCTGGCACTGGTTAGCTCGCATTTACATCT
GCGAGGGGAAGGGCCCAAGAACAACATTGTTGTCATATTAGTAAACGTAA
CTAACTTTAGTTATTGCTGGTGTTGCGACTTCGCACGTTTATGGTCCATT
TAGAAGTATGCAATGGCGATGTTGCGCCGGCTCGCCAACAGATTTATCAC
CGGCTCCTTGCCAATGGAGGCACAAAAGACACACATGCACTGGAAAAAAT
TGTGTATAGAAAATGTTGAATGTTGTCGGAGGGACACTTTTTATTGATAA
ATACTGATTAAATTAGAATGGCAGATTCATTCTAATAAGTTCAAATAAAA
ATGATTTTTTAAGTTATAGGTATATCGTATTAATCATATTTCTATTTAAT
GAAATTTTTATCTGTGTACTTCGAGTCCGTCGGTGGAGCCTTGGTAAAGT
TCATCGATTTCCGCCAACCCAAGACAATAAAAACTGCTCATACCCAACAG
CGGGCAACAAAGATTTGGCAACAAAGTTGCAGGACAATCTGCAGGATCCT
CGTGGCCCATCAAGTGGCCAACTGATCAGCTCGTCGAGGTTGCTGGATAT
ACGAGCTTGAGATGCTGCATCGTAAAAATGTTTGACTGCGCGATTATATG
GCGCTCATGAGAGCGCCACTTTGCCCTGGTCCATCAAACCAAGGCATCCT
CCAGCGAATCCCTTGGAGCCGAAAATCACGTTGATGGAATCCCCAGGCCG
TCAAATCAAAGTTAAGTACACTAAACGAAATCACTGAATGAGCGCGAACC
CAAAAGGCAAATAAAAGCCGAATATACATATATTGTATGTATATATGTAT
ATATATAGCACAGACGTGGCGCAGACTGTATAAATATCGTATAATGTATA
ATTTATGGGCCCGAGGTGAAAATATTTTCAATAGAAGGTGATTTAAATTT
ATTAAAGGAATGCTCACGAGCAGAGCTCCGCACTAAATTAGAATAAGTCG
ATTGGTGGTATGGCGATGGAGATGGGGCTGGGCCATTTGCTCATAAAAGC
CCAAGCAAATTGAATTTGTGGACACCCGATGACCATTCCCGAGCCCAAAA
TTCTCAAATCCCCCAATACCCCCTAGTCCACAACTTCCAATCCCGATCCC
GATTCCGTTCGGAGCTGTAAGTATCGACACGAATGGTGCTCCACGCTCTT
TCGCTTATCAGATGCGAGGAGCTCATTTAAATCTCGGCCAGGCCAGAAAT
AAAGACGCGCATCCACCCGGTTAACCAACCTACAAAAGTCAACGATCCAA
ACCGATCCCATTCCAACCGATCGGATCGGATCCAATCCAAGCCTGCAAGC
TCGCCTTTTGTTAACACCATAATTTACATTGATTTATGTGCTTAGTTGGT
TCGGCATTTTTAATCGGTCCCCATACGATACCATATGATACCAAACCATA
CCATCCATTCTCATCTCCTCGTCGCGTTTAGTCTGTCCCCACTGTGTTTG
TGCGCGCGGCTTCATTTGGTTATAATTAAAATGTCGATGTTATCAGCCAG
ATTTGGACATATTGGCCATTACGTTCGAAATTTAAGCGTTTTCTATGCGC
GTATTTTGGATTTGGATTTTTTTTTTTTTTTTTTTTTTTTTTGATTTCGA
TTTCGTTTGGCTTTTTGTTCTGTCTTCGTTCGGTGTATTAATATTTAATA
ACGTTTTAAGAAGCTTTCGAGTGTTGTTAAATGCTTATTTATGCTTTTCG
GCCGTGTTTGGTGTGTTTGTTTGTTGCCCAGTGTGTTTGAATGGATAATT
ATGCGTGAAATCGAACGTATAAATTGTATTTGTTGTCAAACCAAAGCGAG
TCTATACAAACCGATTTCCTGGTCATATATTTCTGTTTGTTTATTGCCGA
AAGAAAGTAAACGATTCTTCATTATTTCTTGCACTTTTTATTGGTTTCTC
ACTCAGCGGTTGACCATTTTAGTTTTTTTCTTTTATTTGAGCCAAAAACA
CTTAGTCTACGCACTAAATATCAGTTCAAACGCAACCAACTCAAGAATCA
AATCCTTAAACAATACGCATTCATAAATAGATTTGGCTTAGGACTATTTT
AAAGTTTAAAGTTACATATAGTTAGATATTGCATATGCTATAGCCTTAAA
TGGTGATGAGGTAAGTCGGCAGCCGGCGAATGAACAAGTATTATAGTATA
ATTATGCATAACTATAGGGTATACAATGGGCATGTGCATTTCAAGTGGGA
CAAGCGTGTTCGTATCGGGTATTAGTTACAATTTCAGCTAATCTTAAGCC
GCCCATTATGTTGTTGCTGCTGCTTTCTGCTACATTTTTCTGTTTACTTT
TTTCTATTTTTATTTAGTTTTTTTTTTCTTTTTTCTAGCGACCCCGAACC
GCAGCCAAGTAGGTGAGCAGCATTTTAACTTTGGTTTTTCGATTTGTTTG
CCCACTGTGTGTGTAGTCGCTTCTCGTATTTCAGTCCACCAGTTGCAATT
TCAAATGCAATTGCAATTGCATCAGTAGTTGCTGTTGCTTTTGCTGCTTT
TGTTTTTGTTGCCACTGTCAATCACAGAGGCGCGCACAACTCAGGTTTTC
AATTAGACTTTGCCGCCGCCCATCTAGACCAGGTGGCCCTTGTCGCCCAT
GTCGCCCATCTAGCGGTCATGCTTTAGGAATTGCAACGTGGCCGGCGCAT
CGGAGGATGACAGGCGAGCCACCTTTGCCGCCGTTGCCGCCGACGACTCA
ATTTCACCATCGGAATCGTCGTGCACGTTGATCTCCTCATCCGAGTCCGA
TGACGAGTTGTCCACCGTCATGGTTGAGCCGCCAGATTGAGTGGTGTTGG
TATTGGGTCCCGTGCCCTCACCACCGCTCCCCAAACCACCTGCGGAGTAG
TGCAATCTGGAGCGCTGCTCCTCGGCGACCGTTAATGATGCAGCCACGGC
ATATTGCCTGGCCAATCCCAGGAAGGCAGCCGCCGAGGGCGAGCTCACCA
GACTCCTGAAGGCACTACGCTCCCCGCCCATGGAGAGGTGATTCGCCGCC
GGATTGCATCCACTGGGTGAGAGTTGCTGTTGTTGTTGATGATGTTGCTG
CTGCTGCTGCTGATGCTGCTGCTGTTGTTGCTGTTGCTGCTGCTGGTGGT
AGTGGCTGAGCAGCTGGAGGGCAGCTGGATGCGTGGGTAGGTGCAGAGGA
TGATGGTGATGGTGGCCGCCCGGAGGACCATGCAGTGGGTGTAACAGCAC
CGAAGGTGGCGGACCCTGTGGCGAGTGGTCACCGCACAGGGGCAACGGCT
GCTGAGGTGGCGGCACGGGAGCCACTGGAGCGGAGGTGGAGGCACTGCTG
TGGTTACTGGGCGTGGGCGAACTGGCCGGTGCATCGTTCGACTGCTGCGA
GTGCAGCGGATTGGCGGGACTGGAGCGCTGACGCTTCAGGAGATTCATGC
GTTGGTGGCGACGCCATTTAGCCCGGCGATTGGAGAACCACACCTGGAAA
GGGTAGAAATAAATGATATTTAATAAAGATTAGTTATTTGAGGTTTTGGT
TAATTGGCTTTGAAAGAGGTAACTCTAATTTCTGATATAAAAGTATTGAT
TTACTCATTAATTTAAATCAAATGGTATGTAACTACTTTACTAGCCACTT
TTAATCTTGCTTTTTGAAAGTTTTGAGTGAAGCCTTTGTTTTCACCTGAC
TCACCTGAACTCTTGCCTCGCTCAAGCTGGTGCGACTGGACAACCGCTCC
CTGGTGCTCACACAAGGATAATGACTCTTGTCGAACTCCTTCTCCAGCTC
CTCCAACTGCTCCGGACTGAAGGTGGTCCGATTCCGCCTGAACTTGGGCT
CATCATCGTCATCCAGATAATCGGAGTCTATGTGCCGGTTCTCATCCGCT
GATTCCAAGGTATCATGGCTGCCAGAGCCAGGGGAGATGGCCCGATTGGT
TGGTGTGCCACCTGCTCCGCCGGCCATCAAGTGCGCCGAACTGAGGGAGC
CACAAGTGGAGACGGGCACAGCGCTCGCTGCACTCGGAGGCAGATTGGCG
AGCGTGGGAGCGGCAACGGACCACAGGGCGGATGGAGGTGGCGGTGGTGG
TACCCCCTGGCCGCCGGGCACATTGCCGGCCGGATGCCAGGTGAAGCTAC
CGTACGGATGAGGGGGTGGCGGGTACAGGCCATAGGCGGCGGTGCGAGCA
AACTCGGTGGCCACCCGCTCGGCGGCTCGATTGCGCAGGATGCGATTGAT
GCTGCTCACCGATGGAGCGGTGGCATTAGTGCAGACACCTGCAAGGCGGG
ATTACGCAATTACCGAGCAGTCGAAGATCGAGATCAAAAGCTAAAAGCGA
CCGCCGATCAATCAGCGTTCAATCTGCGTCCGCGGATTAGCTGCAATTAT
GTGGAACACTCACCCTCCGAAATCAGGCGTTCTCGTATCTCCCAGGCGAA
GATCGTTGGATTCTCGCGCTTGTACTGTTCGATCTTGGAGACGACCGTCG
GCGTGGCCACCTTGGGCTTTGAGCCACCAATTAAGCCCGGTGGTCGCAGC
GAGCCTGCAAGAATCAGAGCACAATTCCAGTTAAATTATGAGACAATGGA
TTTATGACTTTGCCAGCCTGGTTTTGGCAATCCATCTGTTTTTGGCTGGC
AGCAAGGATTAACCCTGGTTGCTAATATCTTTATCTGCTCGTTTCATCAA
CATGTGATGTATGGAAAATATGAATGGGAAAACAATACAAGCCTTGGCAA
ATACACTGGTAGAAACCAGAGCAGCTCAAGAATTGGAAAACTTAAAAATG
AGTGATTTTAACTACTTAAAGTTACTGTAATGACGGGTTTAAAAGACTTA
AAAAATTCTAAACATGGAATAAATGTGATCACATATCCTTATTTGGAATT
AAGCATTTTTTTCTTTCAGTGCACGGCAGCACGCACCAACCAACACTACC
ACCAAGGAATACCCGCTCGTGAATAAGCCGCATTTTGATTAATGAGCCAG
CCGCGTTTTGGCCACCGCCAGTCAGGAGTTTATGCAATTTTAAGTGGCCA
AATTACACGGCTGCGCACACGAGGGATACGCCACGCAGGGGATGGTAGGG
GCAACTCGCAGGATAATAACATGTTTATCATAAAAATTAGCAAACAAATC
GAAAACAAAGTACCCATTAGTTATCTGATGAGGGAAGGAACTGAGAAACT
GAGCGGTCGTCCCTTTCAAGGGCTCACAACTCACCTAGCAACTTGGAGAC
AGCTCCCTGCTGGGTTAGCATGTGCTGGGCAATGTCATAGCCACGCAGTC
CACCGAAACGTGAGAATTCCAGGAGGCGATGCTGTGACATCAGGGTGTTC
AATGTGCTCCCCGTGGGTCCACCTGCACCGTGCGGAATGCCGCCAGTGGA
GCCGCCGCCGCCAAAGCCGGGTGGTATTTGCACAGATGTGGGTGATGTGG
ATGTGGCCCCTCCGCCACCGGCTACCGCTCCCGATCCCGCTCCGGCCGCC
GCTGCTGCCGCTGCCGCTGCTGCTGCTGCTGCTGCTGCCACGGATGCCGC
CGCTACTGCAATTGAATGATAATTGGGTATTGTTATTTTATTGTGGCTTT
AGCTGTCGCGGCCACAATGGTTAATTATGATAAATTAAGCGTTAATTGTG
TTGACCGAACCGAAATGACTGATGGGTCCTACGAATATATTAGCGTTTCT
ATTACCCCAGCAAATGTCTAAGCTGATCGAATGGCCAAAATGGTGGCGAC
ACGCAATCGAATCTTCCAGGCACGAGCAGATTTATCAAGCTAATTGATAC
GACAATGATCTCTTAGTACAAAAGGCGAAAATTAAAATATGTACTCAGCT
GGATACGAAAAGAAAGCAAAAAACAAGTAGAAAAACAACTGTGTATTACG
TTAATTCGACAGAATATTATATTTGCCTTCGCTTAAAAAACCTACATATA
TCATTCGGCTTGGGCAACTCGTCGCTCAAATTGTCAATTAGCGTTTTAAA
TGCGCGTTTCACTTTTGTTGTTTGTCAAGTAAATATTTTTAAAAAAATAC
GCGCACCTCCAGTCGTGCCTAACTGAATATACATATATGTAAGTATATGG
GCCCATAATCAATTGTGCCGCCCATCAAATGAGAACCAGTTTTGTTTATT
TCGGTCTATTTAAAGGTGAAAAGCAAGGAAATGGGACTGTCAAATGAGCC
ACGCAATTGGTAATGTGACATGCGTAACGATTTGTGTTTGTTTTAACTGA
AGATTTAAGTTGGAATAACATAAAACATTTGTTATGAACATACTAAGTAC
GAACATGACAAATTTTAATCGCTTTCTTATAAATGGCCCACATTGTTTAA
ACTAGAAATATTATAAAGGATCACACTTATTTTATCTTCTGTTTAAGAAA
ATAAAAAGGCACTCAAAGTTAGTTTTACATAGACCTTTGTATGATCAATT
TGATAATTTACATAATTTATCTACCATATACCATTTAAATAAAAAATTGT
TTGTTTTACAGCGAAAAGTTAACACCAACTATATTCAAACTAAATGGATC
TGGTTAAGAATTACACATAAACACATTTGACCCAGTTTGATACTTTATTT
AATACTTTAACCGAAACACCGTTTTAACACACTAATTTAAACGATGCTTA
GTTATTAGTTATACATAATTTCAATAATAGATTTTAGGTTTTATCGCGAA
AGAACTAATTTGTTTAAATTAAAATTCGAACATTCCGGATTTGCTATCGA
ATGACATATTACACCTTTGACCCAGTTTCGGATTTATTTTTTGAAGATTT
GTGTATATTTTCTTAAAATCCCCAAGCCTGGCTTTGCCGTCGGCAAGACT
TCACATGGGCACTTTGGGGCACTTACCACTGGAAGCGTGAGGGGCCAGCG
ATGTGATGCGTTGGGGATGGGGCTCCATTTTCCAGTGCGCGGCCGAGAGG
CCAGAATTAGCGACAGTAAGCGAGCCAAGGTCACGGTTTAAAGTCGGCTC
AATCAACATGTCTAAGAATCGCTCTTTCCAATTCTCTTTATTATTTATTG
TTATTTTATATTTGTTTATTTTATTAATTTTATTTGGGTATAACACAATC
ACAGTCACAAGTGTCGCACATCCAAGGCAGAGGTATCGATTATAGCGAAT
GCAACCGGAAACGGAAATGGAAACGCAATGCGGTCAATTGGATTCATAGC
GTGCTGCTCACTCACACACTCGCATACACACGCACACAGATACACACACA
GTGACAAATGCACGACAGTCGATCCCGACAGAAACAGTTAGAAAACGCTC
CTGCGTATCTCTTGCTCTTATTTTTATTATAGAATTTGTTTTTATCGAAT
TTCTTGCGAACACTGCGCTCCGTTGAAACGTTGTTCACGCGAAAGCTGCT
CTCAGCACAATGAGCGCTTGAATTTCACCTGGTCACCCGGGTCACTCCGC
TCCACTCGAACAGTTTCACTCCGCTTTTGAGTGCTTTTCGAAACGCCAAC
CGGTTTACGAGTACCGTACTTTCATAATGGCGCCCGTTGAGGCAAACTCT
TGCTCTCTCGCTCTTCTGCGCGAGAGCGGGACAACCACATGCACACTATG
CGCGCACACAAATCAAACAATTATAAACTCGTTGTTGGTAAAGTGCTGAG
TATAAACAGTGGCAAGAAGAAGAAGAAGAAGCAGACGAATGAAGAGCAGT
GAGTGTGAGAGAGAGCGAACGCTTTGGGGAAGTGACAAGAAGAAGAACCA
GAATAAGAAGAGAAAGAGGAGTTGGGGAACCCTTTAATTTTAACTACAAA
TGTAGTTGGGATACCATAGCACGTTTGAAGTCAACCTTTAGGTGCATTTC
TCGCCTAATGTAATATTCTAATTGATTGAATTAACCGTACAGCTTAAATT
GTACCATTTAGGAACATTTAGTTCGTAATCTTTACTGTTGAGTAATGCAT
TCAATTTATCGTTACTTTAAGCCAGAGACCATGGCCCCAATAAGTAGGCA
CTTTCAAATACCAACTCTTGATTATCATATCGATCTGTGTACAAATGAGC
TACATTTACAAAAGTTCATGCATATGTATAATCTCTAACAATTAAGGCTA
AAGACTGAAAAGAAGTTTGGCTTTTTGCTTACACTTCTAAAATAAATAAT
AATAATAAAATATTTTATTTCGAAATTATTAAAATAGCTGTAATATTGTA
TCAATAAAATGGCAGTATGGTATGTTTGTTTTACTTTTTATTTGATTCTA
CTCAGGAGAAAGACAAAAAAATATATATAAATAATTGGTAAATAATACCT
CAGCAAAATATAAACATTAGCATTATAATAAAACAGAAAAGCATTAAATT
GCTTCCTTTTTGTGGACTTCATAACTACTATTCCGCTTTTAAACTGACCA
ATTGCAATTAAAACTCGATTTTTAAACATAAACTTATTAAAAGAAGATTT
AAGCCTGAAAGTCCTTTTTAAACAAACTAAATCGTTTATTGCATTGAAAG
ATAACATAAAATGATCGCTAAATAACAATAACTAAAATGCCTGCAATTTA
AAAGAGCTTAGTAGCATATAGCCATTTGAAAGGAATTTTAATCCGGTCAA
ATGTGCAGTGAAGTGGCCAAATTGCATCCATTGCGATCCAGAGTGAACCT
TGGACACGTATAAATCGCATGCGTGGCATGGGCCGTTTGCCATTCAGGTT
TGCACTGCCCGTTTTGGGTCGTTGTCTCCCGGCCTTTGGTGCGTGATGGA
TGATTGATGTGCTGCCTGGGCAAGGCAATCCGATGTGAATCGAAACTGCA
ACTAAACTACACATGGCGTGATCGGGGAGCCACACAGATCACAGCTCGCA
GCTCGCAACTCTCAGAACAGAACGGGGCAGAAACGGGCTACACCAAGTGG
CAGAGTGGCCTGCACAGAAGCCAAATTGCATCAAAGCCCACGGATTGAGT
GGCTCCCGGCGATGCAGGATTCGAATTGGAAGCTGAAAGATGAAAGCTGA
AAGCTGAGAGTCGAGTTAAAAAGCAATTACCTGAAATGATTCCCCAATGG
AATGAGATGGGATGAGATCAGTTGGGATGGGATGGGATCGGGTGGAAAGA
GGAGCGAGTGCAGAAATCTGGATGCGAAACGATATGGTTCAGCAGAATCA
CCTGGCGATAATGAGATGTCTCACTAAGCTGATCAGAACTGCCTTTGTAT
TTATTTGTCTGTTCGAATGCAAAGTGCACAATGCACCGAACACTCGTGCA
TATATGTTTCTTCGATTTGTGAAAGGCGAATCATGAATGAAACGCTGCTG
ACGATGACGTTCGAGTGCCCTCATGCCAGAGATCCAGAGCAAACGCAAAC
AATCGAACAGGAATAATTTACTAAGTAAATAATATCTGGATACCGATCGC
TGCACGGTAAGAAATTGCGTAAACCGGTGACCCATATTGCTCAGCAACCA
AAGAAACCTTTCAGCACTGAGATATTTTTCATTCCATTGTTTTCTGGGAT
AATTTAAAGTAACAGAATTATCTTCTTACAACATTTTTTTGTCTTAACTT
GACAGTAAGAGTTCTTAATTAAAGTCTGAAATTTTTAAAAATATTTTTTA
CGATTTTTTTTTACTAGTTTACTCAAGATCTATAGCAATATTTAAAGAGT
TGAATCAATGGTCTCTATGGAATAGTGTTATATATGGTATATACATATTT
CGTAACCATTTGATCCCAATTTTGGCCAGTGTAATCCCCGCGAGTAGCGT
GCGCCCTCGCCCCATCAAGTGGCACTTCAACAATCAAGCATTCACACAAG
CAGATGGTCCGCAGCCGTTGGCGACCACCTAAATGAAATTTCATTTAGTT
TTTTTTCGCCCGTCATCGCCGCCGCAATCGCAACCCGCTCCTCGAGATCT
CCCCATCCATCGCAGTCCATCCAATCCATCCGTCCAGCGCAGAGTTCCAG
CCCCAATCCCAATCCCAATTCCAATCCCAATACGGTCTCCTATTTGCTTA
TGCACACATTATCAACGTACGCCCGCCTTATGGAGTGTTTGTTTACCTAA
TTCGATTACCGATCGCGTCCGTTCGCGCCATAGTCCACCGGCCACTTGAC
CATTTGGGTGGCACGGATCCGTACTCATGGGGTCCGCTCTTCGGCCAGAC
GTCGTGCGTAATCGCCCCACGGCAGCTGATGCAGTGCAGCGGAATTGGGA
GATGGAGATGGAGATTATGTTGCTGCTGGAGCCGGGGGCCTTAATTGAAG
AACCTGCCACGGGGGTACATACATACATACTTTCATCGCTTTGCAGTCGC
GGAGGTAAATTAAGTCTTAATATCCTAAGTCGAGTGTCTAAAGATTAGGA
AAATAAACACTCAAGGACTTTATCGATTCGTAAAGAAAAATCAAAAGTAA
ACTGCAATTACATTTCAATAATAAACAACCCTATATCAAAGAGTCTTCTT
TAAATTACTGCTTGTCAATTTCTTAAAATTAATAAATAAATCTATTCAAT
CATGTTCTAATTGATAAAAGTAAAGTGTGCCTATTCTCATAAAATTTGTA
TAAACATTCAGGGAGTTATTTAAATAAGGTATATTTACGTATTTATACGT
ATACAGTTATTGAATGTTATTTTTTTTTTTAAATGCCTCGCCAGGAGCTG
TTAAACATATATATTATATTATCTAGATGTTGCACATGGTATTTGAAACA
CTTTTTAAATAAATCTTGGACAAACATGTAAAATTTAGTAGTTATTCTTA
GTAAAAAAAAAGGGTAATGTTGTTTTATTAATTACACTTTTTAAAATTTC
GAATATATTTTTAAATTTAACAGTTTTCTAGAGATGGCAAGCTTTTTTAA
ATAAACTTCGTTAAATATCGATAAGAATTTACCTCATAATCCATACTTTT
AAAATATAACCTTCGGTCACACCAATTCATAGAGCTGGTGCGTATCGATA
GTCGGCACATTCAAAATAAATAAATTCCCAAACACCATTTAATTAAGGTC
AATGGACTTGATTGTGGCGTTATTTTTAAAATCCGAAAATAAATAGCAAT
TGAATTCAAATTTGAATAGCTTAGCACTATCGCTCACTATCGAAATTTAG
CCTCGATAGCAAGTATTCGATTACAGCTACTATCGTGGGGGGTGTACCCA
GCTCTAAAAATTTGTCATTTCGGAACGAATATAGTTAACATTAAATTTAC
GAAGTAAACAGAAACCCCAGAGCCACGATGCGCACAGTGCTGTTGAGCAA
ACACGACGAGCTGTACCTGGAGAAATGCGCACAGGAGAACCAGTTCTCGT
ACGGGATAATCGTGGGCCATGTAAGTGCCATCCGCCACGTAGATTTTGTT
TGGTTCCCCCGCTCAACTGAATCTCCACTTTCTCCTGGTTTCATCCGCTT
CGGTTGAAATAGCAAGCGGATCTCACCAAGAGCGTGGTGGTCCACCTGGC
CAGGAACAACGAGGAGGATGCGGATCTGGAGGACCTGTCGGAGGTCCGGC
TCACCATCTCGGACATCAACTCACAGGCATTGGCCTCCCAGTGGCTGAGC
GCCAGCAAAATGTGTCCCGGATCTTTTGACGTCATCGGTGGGTTTGCGTG
CTGCCCCTGCAGTTTTATCTGCCCTACCCAGAAATAATCATAGTCATAAT
GCTAAGGCATATTATTTATGGGGACCTTGTATTCCTCCCGTGGATTCGAA
ATTTAGCCAAACCCTTTTTTTTTGTATGTTTTGTATATGGGCTAACCCAC
CCAATTTGACTGTTTAATCTGTCAATTCGAAACTTTTGATCTTTCGTCAT
AGATAAATCTTTAAGCTATCAGTAATGGGTAGTGAAACCAGTAATGTAAA
CTTAGGTACTTAACTAAGATGAAAGTAAGCGAAGCTTTAGGACTTACCAT
CTAGAATTAATTATTAATGAATTATTTATCTTTGCAGGAATCTTTGTGTC
TTCAGTAAGATCCGATGTAGTAAACGAACAGAGCGCCGAATTTAAGAATG
CCAAAAAGCTGTTTTCAGATATTTACGAGTAAGTCACTAACTATATGAGT
ATGATATGAGTCTCCATTTGAAATGACCTCTTTTCTTACTTTTCCAGTTT
GCTCCTGAAAAGCAACAGCTCGTTTGGCGTCTACACCACCGACATTGCAC
AGACTGATTTCGTATTCCTCTCGTATTCGCTGGCCGACAAGAAAGTGCTC
TGCAAGAACTACAGCTATGGCAAGTGAGTATCGGAAACGTAATCCCTGAT
CACAGATACGGGTCTCAATGTGTATTCTTTCTTTCACCAAACGAATCGCT
TACAATTTATAACTAGACATTGCAAAAAAACGTATTTTACGGCAAACATA
AAATGCATCATATGGTAACTAAAAAGTTGAGAACTATGTACTTTCATAAC
TTATGTTCTATGTTCAATAATCACTTTCTTTGCTATCCTTGTCCTTGTGT
TTCTTATTTCTTGGAATGCATTTTATGTGTTAGTTAACCATTAGGATTGT
TCATGTTTATATGGTAGTTTGATTACATTCAGACTTTTCCTAGCCTAAAT
ATAATATGAGTATTTCTTTTGATAGCGGCGGCACTTTCACCAATATGGAG
TTCCGGTTTGTGGACAAACCCTTCGAGTGGATTCAGCTGGAGTGCAGCTA
CGATTTCGATGATGTGCTGCCCATACTGGACTCCTCGCGTCGCGTCAACA
TCGAAGACCAGTTCCAGAGTATGATAGTGTCGGTGCGCAAGAACCTGCTC
GCCAGTGAAGTATTCCTCCAAAACGAAGTTGTCGAGGACACCATCGATCT
GCAGGCCTATATCAAAAAGAAAAAGACGAAAGTGGACAAGCTGCAACCGA
CATCGACAACAGGTGGCACGGCCACTGCCTCGAGCAACACCACTGACTCC
CTGCCGCGGCTTGCGTCCGAAGGAATCATCGGAGGCACTGAAACCATCCG
GGCGAGCATCGTGCTCCCCATGAAATGCCAGCTGAGCAAACCGACGGACA
TCAAGGTGCGCGAATTTAGTGGCACGCTGCACATGAGCGGCATTATTACC
TCAAAGGTATTCTGCAATCCTCGAAACAGTATAGCAGATGTTAAGCGTTT
CCTACGCGACGATGTGCTCCGTTCGCTGATAACGCGTATACAAGTGTACT
GCGATGGACTCACCGATCCATATGTGACCAATGAAGCTCTGTACATTAGT
GAGCCGCCGAGACGTGTGTTCTTCAGCCTGCCTTCAGAGGGTCCCAGTGC
GTCGGTCGGAGCAGTAGTTCAGTTTTCCGAGTACTTATTCCGTGGCGAGG
CACCAACTGTTGTGGTGGCCCAGGCTAAACAGATTCTGGACGTGGATCTA
GATCCAGAGACCATATCCGTGGAGGCAGAGGGACTCCCGGATGATACGCA
CTTCAACAATTGCAAGATGGACGCTGATTGCATAGACGATTCTGGGATTA
TGACCAGTTCGATGCCAAAGCCGGAACTTTCGCGCAGCCTTTACATGGTG
GGAATCGCAGTGGCCCTGCTGGTCCTCCTGTCCTCCGTGGCACTTCACTT
TGTCCTAGCCGAGCGGTAGGCAGCTGGGATGCTGGGATGACCGAACCAAT
AAACCAATTTATATGAAATGTTTTTATACAGATACATTAATTGCATGTGT
GCCCACGCACTCACCTCTCTATTGTGATCGTTTGTTTTTATAATTCATTG
TGTACTCGTAGTAGTAAAAAAAAAAAGAATGTGTATAGGGATCACGTTAA
ATAGTTTTATTGTGGAAGCAAAACTGTGCAGCATTTAACACCAATATAAT
AAACTAATAAGTAATATACATATCTGCGATTCTTTGGTACGCCTATAGGG
GAATTTCTCCTTATCTATTTCCATTTAAGAGGATCTAAGTGTTAATTGTA
GTGTATTTTAGTGGTCAAGCTACAGCAATTTAACTTTTTACAGTTCATAT
GGCTTTTTATTTATAATTTATTAATTATTTTACAACCTTAAATCTCAGAT
TCCTGTTTTAACTTATGCCTACCGTAATTATATTAACCTTAAAGAAGAAA
TTAATAATTTCATTAGTAATTGTTTAGCATAAAACATTAAGAGTTCAGTT
ATGTACATTAGGCAAGTTAGAATTGTAACTATATTAAGTGGTAAGTAATA
GTACTTTCAATTAGTACGTGCCTTTAGACTTTAATTACACAATTATTTGG
TTGTCTAAATTAGAATCGAATTTGTTCCTTTGCAACTTCTAGTTCAAAAT
GAGCACATAATAATTGTGTTGTGGTGATCATGCGAAGATTTCTCGCACGA
TTCGAACACTTAAAGTGTAAATTAGTTTTTCACAGCCTCTGCAACTTAGC
GGACCCAAGTCCATGTCTACGAAGTAACCACCGAGATGCCACAGATGCTA
GTGCATCTTGCAGTTGCCATCGCAGTTGACAACCGACCACACCCAGTCCA
CGTAGTTGGGCACCTTGGCATAGATGCCAAACTTATTGCGCTGGGCGCAT
CCATCGCCGAACGAGGTGATGCCAAATATGGTCCACGGATGGTTGGGCTT
CGTGGTGTCCCGACACAGGAGTGGACCTCCTGAATCCCCAGCACACGTGT
CTATGTGACCCTTCTGATGCCCGGCACAAAACATGTTCTAAAATATATAA
CCATAAGTTATTCCATAACTTAATCTTTAGCCACAAGTTAGTACCTTGGT
GATTGTGTAATCGTAGTAAACCTTGCGGCAATTCTGCATCGGTATGATGG
GCACGGTGGCCTTGTGGAGCACACTGGTGCCCGTGGCATCCCGATTGCGA
CGCTTGCCCCAGCCAATTATAGTGCAATCCACGTTTTTGGGCAGCGCCTG
GAAGGGCTGCGGCAAACAGGAGTAACCAATCCAAGTGGTGGCATTGACCG
CCTTGGGTAACCTGTAAAATAAGGTCACTTTTAATGGGATATTTAACTAA
GATGTAGTTACAAACCCACCTTAACAATGCCACATCGCTATCCACGGTGC
GCTTATCAAAGTTGGGATGTGTATAGCTCTTCATCACTCTCAGCTGAATC
TCCGTGCCATCCTCGTAGTTGAGATTGTGTTCCCCTAAAGAAGTACAAAT
GATATAGCTTTCGAAATCCAATAGCCCATGGCATGGTAACCCACCTATTC
GAACAAACAGCACCTTGCGCACACAATGAGCGGCGGTCAGCACCCAGCGA
GGAGCGATTAGTGTGCCCCCGCAGAAGGCTTCCTTGAAGCGATTCAGGAT
AGCCACCTGCCATGGCCACTCGCCCTTGCGCGCCGCCCGTCCTCCGATGA
TCTTCAGCATATTGGACATGCTCCTCCGTCCAGTTCCACTGCGAACAATG
CCGCAGCTTAGCTTTAGAGGAGTGTACTCCGGTCCGCGGTAACCCTTTCC
CGTCATTATGTAGTTGAGGTCATTCATGGACACTTCCGGCTGCTCCGATT
GCATCCTTCGCATCGCATTGGCCGGTGATCCCGATCCCGGTCTTGTCTCA
AAGGCTGGTGTCTTCTGGAACTGCGTCTGCAGCCACTGCTGGCAGAAGCT
GCCCTCCGTGTAGCAGTAGGCGATCTCCCGGAGAACCTCACGGCCACACT
GATCCATGATGCGGCATTTCCTGAAGATGTACAACATTTCTTTATTGGCC
TTGTTGTGTAAAAAACGATTGTAAATTTTAATTGTTTAATGGGATTTTTA
AAGGCATCTCTTTGATCTATATATCTTTTTGTTTTCAATGAAAATGTATC
TATATATTCGAAATATCATCTGAATTCTGAAGAATTCAAAATAACTGACT
GGGAATGGGTGAAGAAAATTAACATAAATATCCTGCTTACTTGTATCTCC
TCGTCGTACATTTTGGCGAACATTTGGTCCATCTACTCCACTTGGAGTAG
ACCTTGCGTCGCCTGAGAGCTATTCCATCCTTTGCTGGCTGCATCCAGGT
GATATTACGAAATTCCCCCTCGGATTCCTGAGAATCCGCGTACATAGTGT
CGGGTAAATCGAAGTCCTCGTACTGAAAAACATCACCCTCCACGCTGCTA
TCCTCACCCAAATGTCTGTGTCTCAGTGACTTCCGTTCGCCAAAGTCCAC
AAAGTCAGAGTCGTCATAGTCTTCCTCCTTGGGAGGTTTCCTGTGGGAGG
GTCTTCTATGATTTTGCCTTCGCCTGTGGCGATGATGTTTGAGCACAAAA
AAGTCACCCTGCTCATCGGAACTTATTAAATCCTCATCTGGTTCGGGTTC
AAGTTCATCTTCCACATCCTCTTCGCTGAATATATCTTTGCCCGGATATT
TTGGCAGGTGGCGCACCACTTCATCAGGATTTGTTGGAGGTGTCGGTGGT
GGAGTTGGTGGATGAGTTGGCGGCGGATAAGTTGGTGGTTGGGTTGGAGG
ATGAGCGGCGGGGTAAGTGGGGGTATAAATAGGTGGATGTGTTGATGGAT
AAAGTGAAGCATAGTTTGGTGGCGGCTTGTATTCGGTGTAGCGATAATCC
ACAGTGGGACCACTTGACGCCGCAGCTGCCGCATTTATAATAATCGACGG
AGGCGGAGGAGGTGGTGGTTGTGGTTGGGGTTGCGGAAGCGGTTGGATTC
TCTCGCGGATGTGGCTATCATCCAGAATTAACGGTGGCTGCCACTTTATT
GCAGGTGCAGGATGACAACTGTGTAGTATAAAAAGATACTCAAGATCTGA
GGGTATTTCACACATAATTTGTTCTCAAGTATGAAAAGTAATAGGATACG
CTGCTCAAATTAGAAATTTTTGGGTATAAACAAACTAAAAAATGTGGCCT
AAAAAATATTCTTAATATTTTTGTGTGAACCAATGCTATAAATAGTCATA
CTCGTAATGCACATGTACTCTAGACTTGCTAGACTTTGTGCTAAATGGGT
TTAAAAATAAGTCAATATGCTTATGAACTTTTAATTTGCACCAGACAAAC
TTGAAAGCACTTAAAGAAATGTAATCAAAATTCTAGAAAGCCTTAAATAA
AACATGTTTTATATGATTCATACTTTTAGGTTATTAAGTATTATTATAGG
TATAAAATAATGCAAAAAGAACTACTTTACTTTAATATATTAAGTATATA
AAATTCGAACTTAATATTCAAACTTCTCTGGTTAAATCTCCACAATCTCC
AACAACTTGCATAATGTTAAATTATAAACACTATTAGTATTTATTTTATT
TTAAGGATACTCACTGGCTGCACTTGCTCTGCTCCACGTGCTTGGTGTGT
CCGCACTTGCGCTTCACCTTGCAGAACCGCTCCCGCCGGCGGACGCACTC
CTCGTCGCATGGTGACCACTGGGACCAGCGACTGAAGGGCTGGTGTTGAT
TGAGCGATCGCCGCCGCCCACTCCAGCGCTGTGGGTGTGGCATCCGGAGA
CGGTGCACCCGCCGCCCATCTATCCAATGCGATGATCCGTGGTGATAGTG
CTGATGGTGTCGATGGCGATGGTGAGCCATCGCATCCCAAATTTCCCTCT
TCGCTTCCTGCACATAGCCACTCTGATGGATGGAAACAATAGGAATTTGT
GTGTGTGTAATAAAGATTGGGTTTTGGATTTCCCACTTTACTGCGGGGTC
GAGTGTGAAATGCGATCTGCGCCCTACGACTTCTTTTGCTGGCCTCAAGG
AGCCCACATTCGCTGCCCAGCTTCCCTGTTCTCCTGCCTCCTCATCCTCT
TTCACATCCACATCCAACCACTATAAATCAGACATGTCGCCGCTTTTTAT
TTGAAGTGTCATTGCTCTCGACAGTCTCGTGTCTGCCAGCGCAGTGTGAT
CCCCGAGGAAAGTGTATGTATGGTGCGATATACCATGGTACACCACAGTC
CCAGCTCCAGTTCCAAATGGGACGCCAGGCGGCGACGCGACGCCGCTCTA
TAAATAACACACGCTTTTCGCCGACCGATCCGGCGGATCCCTGCATCCGT
CCCAGTCGAAAATAGGCTTCGACGTCTGTCGAGGACCGACATAACCGATT
GCCATAACCTCTTCACCAACGCCCTGCAGTCGCCACATCCCCGGGGAACG
GGACACATTCTGGTGCCTCATTGTGCTGCTGAGTACTGATCGTGTAAATG
GGCCAAGTTTTACAACAGATAAGTATATTCACTTGAAGGCGATCATGATC
CATTTTGAGTCACAATCAAGTTGTGAATAATATTCATAACTATACTTCTG
ATTTGAATGAGCTAAGACATGAACGAGTATAATAAAGTTGATGTTTTCAA
GTAAAAATAATAATCTGTAATTTTTCACTCTATAAAAATTGTTACTTTTA
TTCGAAATTAAGCTAGTTTGAGTATGTTAGACATAATTTAATGGCGTCAG
TTTTAAGATTGTCTGACCTCAAAGGGAGATTCGAAATTAATGAAGGCTTC
AAAAAGTTTTATTAGTTCTATGACTGGTTCTAAAAATTCTCGGGAAAATA
AGCATAACCGGTACACTCAAATGACAATATCCAGCAACAAAAGTAGTTCA
TTTATTCCAACCAGCTAACAAATTCTTTCACCTAATCATCTGCCTTTTTT
TTTGCAAAAACAGGAAGCCATTATCGTTCCAGCGAGCAGAAGCGGGGTAA
TCAAGAGATTTTAGTCAATGAATTGAATAGCTAAATTATTTTAATGACCA
TGTTTACAGCTGAAATTAGTCGAATCAAATAAACCAGCACACACTATGTT
CGCATAATGAGGTGCCAATAAATCAGACTCACTCGAAAAACGACGTAGGT
CAGGGTCAAATTGGAAAACTCGAAAACTCAGAAATGGAAAACGCAAACAT
TCCCATCAAATCATGCGGAAATGCGAACCGCTCTGTGCACACCTCAAGCT
CAAGGAGAATCAACTATATGTATATATCGTTCCGCAACCGATTCCGCCGA
TATAACAATATACAAAATAATTCAAAAAAAAAATAAAAAAATCGAGAGTG
CGACTAATTTGGCTGCGGTAATTGACCTTGCATTCGTGAATAAATAGTTC
GCAGTTCCCAAACGAATTGCTTCGGGTTGACGTAATTTACGATACTGGAT
TTTGATTCGAATTTCGACAAGTGGGTGGTTTGATCGACTTATACACACTC
ACCTGAGTTTCGATTAGCAGCTGAACCACCGTGAGGAATTCCAAAACCCA
GCACACCACTTTCATGCTCAATTGCTTCTGGTCTCGTTGTCTCGAAAATC
GAAAATCGATCGGTAGTTTTCAATACCGTCGTAACGAATCCGTGAATCCA
AGAACCTTGACAAATGCACTGCGAATAGAAATGAAATGTGGGTAAGTGGA
TTGTTTCGATTGATGTGTGTATGTTATTTGGGTGTTCGTTCCAGAAGCTC
AACGAATTTAAAGCCGTTTTGAACTTAACCTTGAACTCTTTGAAATACAA
TTGAATAGTAAGTATTATGCCCTCTCATAATCTATAAAATTAATTTGAAT
TTTAGACTAATAACTTGCTGATATAAAAGTTCTATATTCATTCATTTGTG
ATTCATTCATATTCATTCATTTGAATAATGAAGTTGTAGTGACTAATTCA
GATCAAATTGATTAAGTTAATCATCCTTCAGAAGCTTTTAAATTACTTCT
AAGTTAGAGATTTCTAGTTCAATCTTTTTCATTCTATTAGCATATGTAAA
TAGGTATTCTTTGGTATAGGAAAAATCTTAAATAGCTATGGTTTTATACA
ATATACATATCCTCATTTCCCTGGAATGCTCTCATTGGAAAGTTATCTCC
CTACAATTATGCTGACCCCATGGGATTACTCAACATAGCAGCCATCAAAA
TTCCTCTTCACTGTGGGATAGCCCAATTAAATTATATAATACTATACTAC
AGCATAGGCGTACTTGAACCTGTACTTGTTTTATGCTTTTAAGTGCCTAA
TTTACCCAGACTAAGCGACTCATTTGCGTCAAAGTAGACTCATCCAAAAA
CATAAAGAGTGCCCCCCACGCACTGCACAATTAAACGATGCCAATGCCGC
TGTTGGATCAAGTGAATATATATTGTGAATCTGGTGAATCTGTTCGTTTA
ACCGACTCCCTATCTCACCATTCGCCTTTTGGCCAGAAACTACAAAGCAA
ATATTTGAACTTGTCTGGGACCTTAGCACAAAGTGATCAAAAGAGTGGGT
AAAATTATAAAAAAAAAAAATCGAGAAAAAAGTGAAATTAATTAGCTACA
TACCCCGTACATGTAATTACAAACAGAGAACGAAGGAAAAAATTGAAAAC
ATATATAGCTGTGCGCCGAGTGCTTTTGATGCTATGCTCCTCTGCATAAG
TGGGTTTTTCAATATGAAAGGTCTGGTCTAATACTTTTCATTTTCCAACT
GCAACGCGGAATTTTAAGTAGACCCAGAAGAAACCGAACAAGTACATCGT
ACTTCGAACTTGCGTCAACACTGGATCTTGGCCACATCCGCAAAACTGAG
ATATTTAGATACTCGGATGCTCAGATACTCAGATAGTCAGATACTCAGAT
ACTTGGATAGTCAGATAGTTGGATAATCAGATACTCGGATGCTCAGATAC
TCAGCTACTCAGATACTCAGATACTTGGATGCCCAAGTATCGCCCCAACT
ACTGGCGATCATATAAGGTCAGATGCACTGGGGCAACCTACCAGTTGAAT
GCATCGCACGATCCTCTCTCCCACATTCGGCATTCTGGTTATTCCAAATG
ACCAAATTCGATACTGCCATCCCGACCAAGTTTGCTGCAAATTGGCCATT
TATATGCCGCGCTAAATTCCAATAAAAATCGGTGCAATAAAACAGCGAAA
TCCCAGACACTGAACCCAATTCTTCGGGTGTACGAATAACTCGATGTGAT
TTATTTACAATGTGAAATACATATGTACATCCAGCGCCCACTGAACAAAC
TGTGGATATATTGTACATACATATATTCAATTTTATAAGCATCCAATATT
GAGTAACTCGCGATCCGTGAAGAATCTTTTCGCGGGATTTGATGGATACA
CAGATTCACAACAAACAAACCACTAGATACTATTTTAACACACCTGACGA
CACATGATTTATATATCGCGACGGACATTTCCCCACCAAATCTATGTGAC
GTCATCTGCGAGTAAACAAAATGATTTATAAACTATTTCGAAAAGCGATG
TTTGGCGGGAGTTAAGTTCTTTGGGAGATCAAACCAGGAAATACTTTAGT
AGCATTTGTGTAACTTACTATCAGTTGCATTTGGTTTCAAACGAAGAAAG
TGAAAGTAAGGTGGTTTCTATATACGATGTGTTATAAAAAATTAAAGTCT
CTATAAAAAAAAAATAGAACCCCCTTAGTATACGCTCTAAATTTAGATAG
TTTTTCTTATATTAATATAAATATCTAAAGAATTATTCGATTTCATATGT
TTAGCCAGTTTAATTCTAAACATATTTATTTTAAACACTCTTCTTTGTTT
TTAGCTTTTTTGCACTTTGCTTGCTTTTTAATTGATTTTGTCTGGCTGTT
TATTTTTTGGTCCGTCAAAAGTTTCACATTTCCCCAAACTTTGCACGTTC
TGGTCGTATCTCAAGGATACTTTAACGCCAAAACGCATATTAAAACGAAA
GATATTATAAGCTTGTTAGTTTTTTGCTGATTTGGCTGAAATGCTCCGTT
TTGAAAACCACTAAAATGTCCACCCCAGCGTTCAAACAAACAAATTATTT
ATGTACATTTGTGTGTACTTCGAGCGACGCTGCTTCTTAATTTAGATCGC
GATGCGTTCGCATAGCAAACAGAGCAGCAACATCCTCCACCTCCACCATC
TCCGTCTCCGTCTCCGTCAACGGATTCGTACCGCTTCCATACCGCTCCCG
TGTACCGCTCTTGTTTCAATACGTTCGGTGTAAACAAACCGCAGTAGTTG
GCCCGCCCCCCGCAACTGCCTTTCCATGATAAAGTGCGATTAAAAGGCAA
ATATGACGGGGTCGAGTACGCATCTCATAAATATCATAATATTTCCCAGA
TGCCGTTCACTGCCGTATCCAGTGACCAGTTTATCGAATTCCTACAGGTG
AGTAAGCGGTGAGTATTATGATTTGTTTACCAGTTCCGCAAACAAGGTGA
ATCGCCCACAAATTCGATCACCTCCCACCACCCACCGCCCACTTTGCACC
ACCCACTGCCTACGCCCGCTCGGCATGCGGTCCAAATAGTTTTCACTTTT
TTTATTCACTCTTAAATTGCTGTGGAGTCGACTACAACGATTTTTTATGA
ATGAAAATGTACTAATTTGGATCTGGCCAGCCGCTTATCGAGTCTAGAGT
TTTCTGCACTGGCAAAAATAGAGTATACTTTATTTAAAAGCCACTTTACA
TATCTAGCTCTGTTAATTTGGCTTACATGTAAACGAATCAAAGTTGTACC
ATTGAAGTTGTTTACTTAATTAAAAACGTGTTAAAGTGAGCATTCCCTTG
AAATCATATCTATCGTTGTTTTGATAACTATGCAAAGGTTGCTTTATCTA
AAAAAAAATTATTACTTTAATAAATGGAAGGTCAGGTGGTTTATGCCAAC
AAGAGATAGAAAGTGAATATTTTTTAATTTATTTTCATTTTTGTTTTTTC
ACTTTGTTTAGATCTTTTTCGCAGTGCAGCTGGCTGATTTATTTTTTGTG
GCTCTTTGGCCGGCTAGCCACAATGTCTGGTATGGCCAATCAAGTGTCGT
TGTGTGTGTGCAACTGCGTGTGTGTGTGTGTGTCTATGTTGCATGACCGC
GGGCCCGTTTAACCAAATGCAATTTTAATGACGTGACCAGCTACTAAAAA
AAAAGCCCAATCGCTGCGAGCTGGCTGTCGCTGGCTTTTGTTTTTCCTAT
TTATCTGCCGCCGACTAAGTGGGCAGTTCGTGGGCAGCATGGGCCATTTG
AGCATTTGAGCATTTGGGCATTTGGGCATTTGGTATTGTCCACAGATTTT
GGCCAGCTTTATTTGTTAGTCAGCCTTTTGTAATCGGCGGGGCATTAAGT
CTGCTGTGCGACATCGGCCACATGAGTTGTATTAGCGGAAGTGTTGGAAA
TAAATCATGCTTCGCATCCACGCACACAAAGCGGCGCACACACAAATGCA
CAATTTTCATCGACATCGATGGGGCATCGCAAAGACGCCGACGAACTGCC
TCCGCCCAGCACCCCACAAGCCGGCGATCCCTAGGCACCCAGCATCCGAA
CATCCGGGCGAGCGAATCCACATCCACGCATCCATGGATCCCCTGCCCGC
CGCACCGCACCACCAGAACACCCAATTTTCCACAGATGAATTAAATGCAT
TTTAAACACACATGCAACAACAGATGGGGTCAAATTAATAGCAGTGTACG
CCGCATATGTATCTTCAAGATTGATAAACAAACGCACTGTGTACTTTTTC
GTAGATCAATCATTCGATTCATGATGTAACTGTCTTATAATTACAAAACT
CTTTCTATATTCCAGTGAATACAAAACTATCTAATACATTTTAAATGCAT
CTTGGCTGTATTTTAAATATAACTCCAAAGTTTGTAGACAAGCTTCAAAA
TTATTTTAAACATTTGTTTTAGATATTCGCACCTCTGTTTTTTTTTTCAA
GTTCCATAAACATTTCCGTTCCAAATTCTCATTAACATAATTTATTTTCA
AGACAACCGAATGTTTCAACCACAAAAATGTCTTTTTGGTAACTAAATGT
CGCAAAGATATAAATTTTGACCAAAAAACATAATTAATTAGGGGATTTTT
CTATAGGCGCTACGAAACAGAAGTATTTTTTTTTTTTTTTTTGAGAATCT
TGCATGATTCATGGGAAATATGCAACATAAAATCGTTCACACTATATTTT
AGTTTTTGTGCGTTTTTTTAATTGCTATTATTTTGACTGCATGTGTAGAA
TAGCATGCGTGCAGATCCAAATACATCTGCGTTCTCATGGGTATTTGTGG
CTATGCGAACGCGGATTGTTTTCATGAATGAAACATTTTTTATTCCATTT
ATCACTTGGCACCATGTCTCCTTCAGCTGCACTTCGATTAGCGACTTGGC
AGCATTTTTGTTTCGGTTTAAGAACTATAAACCGACGCACTTTGCATATA
AACACGGCTAACTGGCCCATACATTATTTGGCTTTTATGACTCGAATATT
GAACTGTCAACCGTTTAGCGTTAATTTTACCCAACGATTACCTAGTTGAC
ACCACTGGATCGCTCGAGTTTCCTTCTTTTTTTTTCGAAAATGTTTCAAA
ATCCGTTTTGCGCACACATATTGAAGCAGTTTTTATTTTTACATTGGAGA
ACCACGTCGGATGTCGGATGTCGCCTCGCAAACTCCGCGTAAACAACCCG
ATCCCGTCCAGGCCCAATCGTTCCGTATCCCGTATTCCGTTCCGTTTCGT
TCAGATCCAATCCGATCCGATCCGATCCAACCGACGTCTTCTCGAGAACT
GAGACTGAGCGAAGCAAAACGCCAACGCTCCGCGGCGAGCTGAAAAACGT
CGCGTTTGCCGTTGACTTTTCCACACACATGTTGGCCGTGCACAGTGGTC
TGGAACCGAGTGAAAAATGTGCGGATCGCTTTGAAAATCCCAGGGGGACG
CACAAATGCTTCCACGATTTCTGCGAATTGCGAATGCAGGCAAAGGTGCT
AGTACACCGAGAAAAACTCAAACGAAGTCTGTTCTACTCTAGTACAGAAA
AAATATTTTTTAATTTTACATTAATCATTGATCTTCAAAATGCTAAAAAT
AATGTTTTAGTTTAGTTACTCGACTATCTGCTTGGATGAACTTGTTAATC
CCGATCAAGGATCAAAAACAGCTTCTTTTACGTCTTTCGTTGGAATCGAT
TTCTCGTGCAAAAGATAAAACATAACTGATAAAAATTCAGTATGGAAATA
AGTAAACATGTTCATGTAATTTGAAAATAATTACAATTTAAACAAAGCAA
AAAAATAAAAGTATTTAGATATGAACATATGTATAATTACATTGTTAACT
GGCGAAATTGCTAAATCGATTAGTATTTTGATAATGTCATCAAATACAAT
TAACATAAATAACAATAAGTTTTTAGTACCATGTTGTCAAAGCTAGTTAC
AAGTATTCTCTGCGTCGCAGTTGGCATTCTCGTCATTGATTTAAATGTAA
AAACAAAAGAGTTGTTAAGTAGTATAAAATAGTTACATAATGTAACCTTC
ACAGGATGCCGTCGTCTTCAAGTTTACGAACTTCGCCTGTCTAAGTCGCA
ATCAATCCTGGTTTGTGTTCCACAATTGTCGTCTGAAGGCGGTCAGTCGT
GAGAAGGTCTTACTCAACTTTAATGGAACGGTTCTACATCCGGCCAATAA
CATAATAGTTCACGTCAAGCTGTTTAAAAAGGCCAACGGTTTTAAGCCTT
GGTTATTAGACGTAAAACTCGATGCTTGTCGCTTTGTGCGGACCAACTTC
CATCCGTTTGTACGCATTATATTCGATCTCTTCAAAGATTTCTCCACCAT
AAACCACACGTGCCCATATGTGGTAAGTATTTTAAAATTAATAACTCAAC
ATTTAATTTGGTATCACAACATTGCATTACCACAGGGCCTGCAAGTCGTA
AAGGATTTCTATCTCAGGCCCGAGAAATTGAAGCTGCCATTTCCATCTGG
AGACTATTTGCTATCTTTAATATGGATATTCGACAAAAGGCCACAGTTCG
ATACGAATGTTTCTTTTGTTTATGCAGAGGATCTCATAAACGCATAATCA
TCGAAACTAGAGATCGACTAACAGATACCCATTACTGAGCTTGTGAAATT
TGAAATGAATAAAATCAAAATATTTGCGGGCCCGGTTAATTTGAGAAACT
TTTTTTGAAATATTTTCGATGGACAATTATTGAAACTAATCCCTTTAAAA
AAAAAATACCCTTCCATGCTGATTATTTGCAAAAAAACCAAATAAGGCAC
AATTATTTTCACTGCACAGCTATTGTACTTCCAATGGCAGTAAACCGAAT
GTTACACTCCATGGACGTTCAAATGAGCCAAACTTTCCCAAAGAAGCACT
TCACAATTCGCAATTAAATTTAATATTTTTAACGATCGCAAAGTAAATGC
ATACAGCAGAAATACATATATATGCACAAGGGAATTTCTATATCATTAAA
CTTAGGATTTTTGCTATGTACATTCAGTTTGGCGTGTTGATTTGAGTACG
GCTTAGTGGTAACAGTGCCAGGCGGCCACCCGCTGACCTGGCGGGGATTC
CCGGATGAGTCGCATCTGCTCGGAGCCCGTATCCCCCGCCTGATCTCCGC
CGACTATGACGGTGCCGAGCACCAGTTTCTTGCCCATCTTCTTGGTGGCC
AATGTGATGCGCAGCACGATGTCCTCCAACTGATCGAGTCTCTGGAGCGG
TATATCTATCGTACCCTCACCGGATCCATCGTCCCACTTGGTGGACAGCG
AGGGAAAGAAAATGGGGGACTTCCAGGCGTCTATGTAGATGCCGTGCTCG
AAGGCCGTGGTCTTCACATACACACCGGAGCTCGCCGTGGCCTCCAGCTC
ATCCTTGACCTTATTGGAGCAACGCATCCGTGTGGTGGTCACCCGGAGCA
GGTATCTGCCGGAGTCGCTGTTGCCGGCATTGCTAATGCCCATTTTCCGC
TTCACTTCGGCGGTCATCCGTTGCCAATTGTTGGTCGCATGGGTGGCAAG
TGGAGATGGAGGATCTGGTGTAGTGGGCGTGTTCGTGGGCGTGGCAGGGG
GCAGTGAAATATCCACAGGTGTCTCACATTCCAGGAGATCTCGCACCTCG
AGAGCCAGTTCGACCACACCCTTGGTGGAGTTAACCAACTGAAAGATAAT
AATACTAATTTACTAGATATTCCCCAAGTTGAAAAGTATCTTAGAATAAA
CTGCACTCTTCCTATATCTCATAATTGATGCATTTATGACAAGATACTTA
ATCAATAATTGAATTTCATAAGCAAACTGCTGACGATATACCAACCAACT
GGGCGTAAAAAGCTCGGCATTTATAGAGTTTGTCAACAAATTGAAATCGC
ATTGCCATGATAAGATAAAACTCGAATTGACCCACACTGAAAATTGGTTC
AAAACATATAGGTTCTTCAGATATATCGCCACATTAGGTGAGGGGAAAAA
AACGCAATGGGTTGGCTTTTTAATTCATTTTTTCCGGCGTAATATTGACT
CAGCCTGCACATTAGTGTTTCTGTTGCAATTAAAAAATTTGCTTTCATTT
AAATTTTATAGTGGCTGTGTTGTTGTGGTTTTCCCGACCAACCGGGAAGC
TTTCACTTTGCACAATTAAGGCGCACACATCTCCATTACATTTGAAAAAA
AAAAAAACACCCGTCGTCCGCATGTCGCATTTTGTTTTGTAACACCAATT
TCGGGTGAACTTGTTTAGCAATGCTCTGGGTCAGGTACTATATACTCTAT
ACACATGTTGTTTTCCTACTCACATTGTTGTTGCTGGGTGACGACTTGGC
CACCGTCGTGGTGATATCTTTGATAGGCAGCCACAGCTCTTCCGTGGAAT
AGCACCCCGTGCGGCTGTTGCGCTGGAAGAGCTTCGATTCCAGGTAACAG
GTGACGGAACCTGAAGCAGAAAAAGATGCAGATCGAACAGAAAGTTATAG
ACAAAAATATAGGACAACATTTACAGATTAATGACTATCTATCCGAATTT
GAATTTTTATTTGTCTATATAAGTAAAGGGTATAATATTATGTAAAGCAA
TAGTATATCTACTGCATTTTTAATTAAATATATGTATTATATAGTTTATA
ATAAGGAAAATATACCCCTCATTTTCACAAACCAATAAAACCAATAAAAT
TATTGAGAAATTTAAAATTTGTCCAAAAGTATGCAGTAGAATTGGAGCTT
AGTTTGCACAATTTAAGATACTTCTATAGATCTGGGTTACATTACCTATA
TTTCTGCGCGATTCACTGATGGTCAGCGGTGGCATCGCATCCCGAGCGGA
GCTCTCCGACGACTTCTTCCTGCCCTTTCCCTGGTCACTTGGCTTTCCGC
CGGCCTCAGTCTTTGCCTCACTTGGAGCACTCGCAGTTGGATCCACGAAA
CGCTGCACAAAGCTGGTGCTTCTATCTTTTAGCGAGCGGTATGTCTTGTT
AAAGCGATTGAAGTTCTGGTAAGAAGGGTATTTAATCCACGTTAGTTAGC
TTGTCATGGCCAACTTACCGTTGCCGGAAGTTCCAGTAGCGCGTAGACCG
TAAAGACCAAAAATTGCCCGGAAAAGAGTTGTTCCGGCTCCTGATCCGAG
CTGCTTACCTGTCCATTTGCGGGACGTCGAGCCACATGTTTCATAGAGGA
TCTTTACAATTTTTATAATAATATTGCTAATTTTTTTTTATATCCCACTT
ACTTGATATCCGGCACCAGGGGAAACTTGAAATTTTCATTGAACTTTGGC
CATGTATTCGTCTGAATGCTGCTGTCCAAGCGTTTCGAACCGGGAAAAAG
CTTCACCTGTGATCAAGAAGTTGAGAAATTTAAAATATTAGATATAAAAA
TAAATAAATTGTGGGACGTGCTGAGGGTCTTTGAAGTGAGATGAGAAAAT
AATACAAAACTATTGTGTACAAATGGGTATTAATTCATTTGATCTGGATT
GATTGTTTATTTGGCAGCAATCTTGAATCTTGAAATCATAACAAAACTTA
TTTATTCAAGTGCTGACCACAACAAGTTTACGTTTAATACAATAATTTTT
AAATTGTATTATTATTACGATAAGAACATTGTTAAGATTAAGGTTAATTA
TTCATCCGTTATCAGAAGAGCAAAAAAAATAAAATCTATACTCTGTTGAA
TTCACATCCTTAGGAAAAACAAGTAAATATTTACTTCCTGTCAAATGAAG
TGCTTTTATCTCACAGTTTAAGTATTTATAACTTTTGTTAATATATGTCA
TCGTAATTCAAGGATAAAATTATCAAAAACTGTTTAAAAATCAGTATATA
TTGACACTATATTACTTATCAAATTGGTGGAGAATCAAAGAAATTCTCCT
TTTCTGTCATTTTGAGTGTGCCTTTATCTCAGACCATTTTCGTGGCATGT
CTCATATCGTGACTAATTAGCACTAATTTACCTTTATAAGATACCCCTGG
ACGATCTTGAAGCCGAAAAGAGAGGGCAAATGTCGCGCGGCGATGAGATG
GACATTCAGTTCGGGCACCGCCGTGGAACCCTTGCTCTGATCGTTGTTTT
TTGGATTGTCAATGGTGATCTGGAATCCGATCTCCGGCTCCAGAGTTACG
GAGTGCCGGGATGCTCCATTGGAGCCAGAATGTTGGCCGGGCAGCAGGGC
CCGTAGTTTGTTCATGATGTCCGGGTGATCCGGCTGCTACTTCAACCGGG
TATGGGAATGGAATGCAATCCGCTTTTCCATTCGATTGCGCAAAGGCGAA
GAAGCGATAAATTGTGTAAGTGACTTAACACCCGCCGCCGACTTTTTCTT
ATCTCTATGAATCGTACTTCAAACTGATAAAACCTGCCCCACTCGCTCTC
GCGCTCGCTCGCATTCTCTCTTTCTCTCTCAGCAAAGTGCAGTGCTCTCA
GCTTGGAGAAGGGAAAATAAACCACAAAGCTCCAGAAACAGCTGTTGATT
GAAAACTTTTGCACCGCAAAGCTCACTCTCCACCACTCCCAATCCCAATA
GGTAATCGTGACCGTTGGAATTAGATACGCGCGCGGGGCAATCTTATGGA
TGTGTGAAAAAGTATCTTAAAAGTAGTTACTGCCCAAAGATGCACTTCAC
GAATCCATCGCACAGATGAAGGGATCATAAAATCCGAACTAAATCACAAG
AACCAACGGATTACACGGAATTGCCCAACTCGCCATTGTTGAGATGTCCA
CAAGTGTTTGGGGTCAGCACACAAAGCGGAGCACTTGTCGCGACAATTAG
CGACTTAAATCGCGAATGAGAACGAGTATCTGTATCTGTGTCTCAGTTTG
AATCGGATTCGGATGGCGATCCGATCTGGACGCTCGCGTTCTTCAGCTGT
TCCAGCGCTCAACTGAAAAGTTAACTTGGAAATTACTTCGTATGCGGCCA
TAATAATAAGCGTACAATCATAATGCCGACACACATTCGCGCGCTCACAC
GTACAGCAGCGGGCAAAAATCTAGCATCTCAGAGTAAAGTTAAGATGTGA
CAAAAGCAAGCGGATGTTACTATCTTAAGTAGAAGTGAGGAAGTATAAGT
ATATATTTCTTTCTTATACCACAAACTATATGTGTAATTAGTTATTATTT
AACTAGTAAATTGTATTTCGTTGACTTCACTTGTGAGCACGAGTGTCGGG
CACAAACAAACGCTCACACCTAAATCCAAAGAACTTTTGTTCTCTTATTG
TGCTTGTAGAATGCACTCAGATTCTCTCAACGCCATTTGTGTCATAGTTA
CCGCTAAAGAAAAGAACAGCAGCCATAGACAACCTATAACAAACCTCTTG
GGAAAACGAAGATCGGCGGAACGACTTTTTTCGTTCGCTTAGCTGCTCAC
CGCGGAATTAACCACTTAGCGACTGCACTGTAATTTCAAGATTCTCGTTA
CGAAACAACCTCCCATTCTTACCGTTTCTACGGTAGATACATTGTTGCAC
ATTCAGTGGGTAATAATAATAATAGGTCATCTTTTTTTTAAAAGGCAGAA
ATTAGTTAAATAAATAAAACGTTCCATATTAGGAATGTGTTTCACCAAAT
GCCTTAGCCAATACACCAACCAATGCCCTATCGAATATTTTAAAAAACAC
ACCAACCAAACATTTTACACAACCTAATATCAATCATAAACTATAGGTGT
TTCTACCAAGTATGTATCTTTGATGATATTGCCCAGTAGCGTCCTATATA
CGGAATAAGTAGTTCATAGTTGCGCCATAGGAACATTATTCTACGTACTG
GCTTTTAGTAAATCTTAGTTACAGCCTAGGTACTTCATAGGTACCGCCTA
GGTACAGATTTTGAACTGCCGAAGTACGTTCTAAGAACTAGCCATACATT
TGTTGGTTGTATTATTTTTGCGATTTGGTTATGGGATTCGAAATGAAGCC
TATCCTCACTGGATATACACATGTGCTCACTCTTGGTGGACATTCTAAAA
TATATTATTACATGCACTTAACTCGCAGCTTGAAAAGATCCCAATAAACC
ATAAAGTGAAGCCAGGAATTAAAATTCTCAAGAATAAGTATATACATATA
TTTAAATAGACATTCATTTAAGATAACGTAACGCATGGATGGAATATACA
ACTGTGGAAACTCAGCCACAGGCCCAGCAACTATGGGATTCTGAGGATTG
GAGGACCACGACCCACTGGAGGGAGTCACAGTTCCCGCGAGACCGTAGTT
ATACAACTTAGTGGTGATGCTTTTAAATAGGTACGAAGTGTGCATGCCCG
CGCGTCTTGTCGATTGTCTCAATGGTATCCAGACCTAGCCTAGCTTAGCC
TACGGGATTAAGGGGATTGCTCCACGGCGGGCTCTAGTCCACCTCCAGTT
TCCTAAAACTGCCCACGACACCGGCATCGATGTCGCCGATATCATTACCA
GCAAAATTGGCCGCATCCTTGGTCACCTCGATCTGCATGTCGTCGAGTGC
AAGGATTGCCGCCCGGCGTTGCTGCAACTTCTGTTTGAACTGGGCGATCA
TATCGGCAATGGGCACGGTGCCACCATATTCCTTGGGCAGGATGGCGGGA
TCGATCTTTGTCTTCAAAATGTCAACATTCTTGTGCACCTGAAGGGGAAA
AAATCAATACAATCAGCACATGTATTACAATGACAATCGAAATGAGCTCA
CAATGATTCGCTTCTTAAGCTTATCGCTCAGCATGGACACGCCCAGCTCG
ATGATGCGATTGGCGTAGTGGGGTATGTTGACGAAGTGCGTCTCCTTGTG
CCGCATCGGCGTCGAGTTCTGGATGCACTTGACAATGCTGCGCAGGTCGG
TCAGAGACCAGAGGCTAACGAAGCCCATGTTCATGCCACTCTCGTCGTTG
ATGTACACATATCCAGCCACCTGAGAATCCTCATCATCCAGCAGTGCCTC
GCAGACCAGACTGTGCACCCGCGCCATTTGCACCGAAGTGAACTGGAATG
AACATTGGATAGCTATTAAACGTTTCTATAGATGTAAATTCCAAAAGAGA
TCCTGACCTTGTACGGATCGAACTTGGCGGCCACGGAGAAGATGACCTGA
CGTCCGGTGGAATCGCGCTGCGGCAGCGGCACCAGATAACCATTCTCGAA
GATCTCATTGATGGCCGGATCGTTGATGTCCAGCTGCTTGAACCACTGCG
GGAACAGCTGCCGGATGGTCAGATAGCGCTCGAGCATTTCGCAGGCGGAT
GGTACGGAGAACTTTTTGGTGCGCAAAAAACGCAGCAGGAAGACGGTATC
GGTGCGGCACTTGCGGATATGCGGATGCTTCTCGATCCACTCGCGGAACT
GGGCCAGCGCCTGCCGACGTATGTTCTCGTCCTCGTGCAGCTCCTCCTTG
GCCACCAGCTTCATTGCCGGACTCAGTCCGCAGACATACGGATAGTCATA
GTCGCCGCCGCTACTGGCAGCCGGTCCACTCAGCTTCGGTTGTTGCAGCA
CCTCGGTCTCAAGCACTGAAATCGGGCCAAAACATATACATATATGTTTT
AGTTGCAAAATTCTATTGCACAGGTTGCAAGTGTATGTCTACATTCAATA
CCATATTACACAATTTATGTGCTCAAAATCAAGAAATCAAGTGAGCAGAA
CGCATAAAGTCACGGATTTCAGTGGTTTAAGTAAGCCATGTCCAATTAAC
ACTTTCACTTTTCAGTTTAGGCCACAGCTGCCAAATATTTACTCGATTTC
CCTAAAAGTTTACGATCTACCTGCTGAATTTCCCTTTGATTACACTGCTC
CAAATGAAATCGGGTATTAAAATTCGAGATGCATGGATACGTGCTTAAAA
ACAAAGATTTTAATGTTATTTCAAACCTTGTAATTAAAAAGTTGAACTTT
AAGTTTAATTTATTTAACAGCACGTTATTAAGATTGTTACTTAAAGAAAA
AAAAACCCAAATATACATTTATTCTGAATATCCAGTTCTATGTTTTGAAC
TCAATTATTAAGGTAACTATTTGCAATAATTGCCTTTTTAAAATATTTGT
TAAAAAGCTAGGGCTTACTTCCCTGTTATTTATTATACATAATTACAATT
ATTATAAGTATACCTTAGCTGAGTAAGCTGAACATTACAAAGTAAAATTA
AGTTATTTCCCTGATTTTAATTACCGATTTAAACTTGAACTCAGTGAACG
AATATGAATGTAAATGAAAGTAAAATAAAGTCATAGTTATCTTAAATTGG
GATCGCTTGAATGCATTTAAGCTATTTATAGATTCAATATATCTGTTAAT
CGAACTGCATTTTTTGGCTGTCCGTGAGCGAAATAATGGGCTAAAATGGC
CAAGTGGCTAAGTGATCGCTGCCAGTTAGCCAGATTTCTTCACGGCTGAC
ACCAGCGACTCTAATTGGCCGGTTGCCCTTGGGGTCGTTGGCGATTGTGC
AATCCGAAATGTTAAAATTCATCGAACTCTCAAGGGTCAGCGCAGTTTAC
TGGACCACCACCTCCGCCATGTCACTCCAACAAACAAACATACATACATA
CATATGTATGTATATTTATGCATACCAATTAATCCCACTTGACTCTTGGC
TGCACAATGTCAGGCAAATGGACTGGGGAACTGGATATAGCGATGGCTAC
CAGCGACCAGGGTGCAATGCCTTGCGTGGGTTACTTCGCCAGTTGGAAGC
AGCTGCCCACAGTCGCATGCCGCGCGATCGATTGGCTAATCCAAATCCCG
TCCAGAGATGCTGGCATTTCCGCGTATTTTTTTTTTTTTTCGCCTAACCA
CACTTTATTGGTCTTACACAGGTCCATTGACCGTGACCCAAAATCCGCCG
GCTGACAGACCGACTGTTTTGCATACGAATCGAATGTGTTTGGTGTTGTC
ATTTCGTAGCCCATTTAAATTTCTAGTCGTTTAAAAACGCAGACGAAGGT
CGAGAGAAAGATGCGCAAGGCTGCGGAGTAACCGCCCAGTAATTGCGGAT
CGGATGACAGCTGGCTGGCCGGATTGGTTGGCCGGATTGGATGGTCCAAC
TATTTTTTGGTCAACAAACTGTTTATGACCAGTTTGTTCACTTTCATGGC
CTTCACACAGTTTCCAACGCAATCGATCCGCTGCGATGGACGCTGATGTA
AAATAAATTGAACGTATGGAATTGCCCTGCTTTGAATACGTTCAATATGG
GAATGGGTATGGCTATGGGTATGGCTATGGGTATTGTTTATATGGTATGA
AAGTTTCGGGCATTGGTAACTCGATCATTTATGGGCCATGCGATGCCATG
ACGTGCTGAAGATGTCCGCTGTCCACCGTCCACTCCGTCCACTCATCCAT
TGGGGAGCAGTGAAACATGCGATTTGTAATTTCGTTATCGTTTCTGTTGC
GTCCGTTTTCCGCTCCGCCAATTAGCCCGCTGGTTACATCATATCATATC
GCAGCATAAAAGCTGGCAAACCGAAGTACCAACGTCTTACCATGTCGCCA
ACTTTTGGTAAGAGTAAGGAGTGCAGGCGGCGAGAAATGCTCAAAACTGG
TTTTACCATCCCACCACTCGAACCGATCCACTCCCATTACACGGTGAGAA
ATGACTGGCATCCCCACATCCGGTCAATTGAGATATTCAGCAATTGAGTG
CTACATTCACTCAAATAACTCAGAATATAATCGATAAGATTTTAATACTA
TTCCTACACGATGATCTAGTTAACTTACTAACTTATTATAATTAAACTTT
ATAATCTTAGTTGAATCTCACTATAAAATACATTTTGTTTGGCACAACAG
TTAACACTTAATCATCAAATGACTTGTGTTTTTCATTATCTACTACCTAA
GTCAGATTCAAGAGCAAGGCTTTTTCGCGCAAGTAACCCCCTAATTTCTC
ACCGTGCACTTGCCCAATCCCACCCCATGACCGTGCACATTGCCAATATG
TGTTTGCTTTGACTCAATTTCGTATTTCGAATGGGCAAACAGTTGAGTTT
ACGATTTGGCGGCGATTTGCATCTGCCTTTCCGGATTATCATGCAGATTG
CATTTTGCCACAATTACGACAATAGTTCGCTAATGTTCCCCGGATGAGTA
GCGCTTTATATTCATGTGTGTCAGAATCTAATGGCACTGATTACAGGGCG
GAATTCATTAGCCAGGCTAACCACGTTCGCCACCCAAGGCTTTTGTGGCC
CATTCCAGTCGGTTGGTCAAGGTAGCGTTATGGAGTTAAAACTCCATTCC
ACTGCACTTGTAACTGGAAAACTGGCCATCCAACTCACTAGACATATGGC
ACCCAGAATTACCGACGAGGTCGTGGCTGTTGGTCAAAGGAAACCGTCAC
GTCGATGGCTTTGTCCCTGGCAATTGCACAATAGCCACTTGCCATGAATA
TTTATATGCGAACCGCACAAATTGCATTGCATTGAGTACGTTTTCCAACC
AAACAACATAACCGACCAACTTGGCTTTTACGGTATTGGCCAACTTCGGC
TGTCGGCCGAGAAGACCTTGTGCGCCCGGGCCTCTTGTGGTCTGGCTGGG
CAATTAAGCCAGCAAACAGAATTACAAAACTCTCGAAGAGCTGCTAACTA
TTGGCCTTTAAATAATTGACTAGAGCGAAGCACTTGCAGTGGGTCAATAA
AGCACAATTAAAAGGCTCTAAACAAAAAACTATACGATTTTAGTTTGGCT
ACACCCACGCACCTAGTTTAGAGCAATCAACAAAGGTGTGCAAGTGCTAC
ACTGGGAGAAATTCAAGGAGCTAGCGAAATATAACTAAAAATATTATTAT
TATTTACATTTTAAATTGAAATATTATTGCGCAAAGATTTTAGAAAACAT
TTTAATAGCTTACTATGAAAAGAGCCTATGAAAAAATCCTTTAAAAATAG
CTCATATATCATATCTATAATTTTATATATTTACCAACTATAGTATCATT
CTAAGAATCTATCTTTTCTGGCTCAAAAAGTACAAATGTATCTTATTTGG
GAACCTGATTTATTCAAGTCGATAGTGTGGCTGGTTTATCCCCGGCAAAC
AGTAGCAATCTGCGAATGTATCTGCGCATGCGCAGCAGCTGCAGCCAGCT
GTACTTGGGTGAAAGCGAAAGTTTTTCCCCGCCACCTCGCTTTTCTCGGG
CCTTTACATAATGCACGATTCGATCCTTTTTGGTTTTGCAACCAAATAGA
TGGTATATGTGGGGGGGGGGGGGGGGGTTGTAATTCTCAGCTCAACTCAC
TTTTGGTCTTACGCACTGGCACTGCGTGGATTTCACAAGTTGTTAAACTT
ATATAACAATATTTGGACGCGTCGCAGGGGAGGGATGTGGCTGAATTCCG
GGGCTCTAATTGATCGCCGGAATATATGTGTATATATATCCGTGTATGAG
TTCCGCAACTGAACTGGCGACGATGTGAACGTGGGCACGCTTGGAGCGAA
ACTGCCAATTTTTTGACTGAAAATTTATTTAAACCTCACGCTCTCGGCCG
CAATTCACTCACTCAAACGCTTGAGTGGAATTTTGGTTGGAGTGGAGAGG
CTAAGAGGCTCAGTGGAGCACTTAGTGAGCATCCGATCCCAGCTAGGAGA
TACCCATCTGCAGCATGGAAAGTGGTTTTGGTGGGTTATGTTATTCTTGG
CCTGGGTCAAGGTGGCGCATGCCACAGATTCTCCTCTAATCGACTCGTGG
AGCAGCACGTAAGTCCAAGTCCGGTCCGCTATTTAATTCACTCATCCATG
CACTATTTTGGGGCAGCTCAAAGGCTAGACGACCCCAATTTCATTCAGCC
CGTGCTCATCTTGGCTGGCTCTGACGTCACCCCACAGGCCGAGGTGCTAT
TTACAAAGGTCTACGGCGGCGCGATTAACCCAAAATGTACCCAACAATCC
AAAGATAATTAGCCTGTCGGGCGTAATAGGTACATCAACTAATAGCCATA
ATACTTTCATGCTTCATTTCTGCGGTTGGCGCAACTAATAGCTTCCGCGT
GATATTTTTTGGCCATACATCAGAATAGAAGATCCATTGATAAGAGAATG
TTGGCAAACAAAAAATGCGTCCTTAAAATTGATGTAGCAATTTAGGCTAA
CAGCTGGCAATCAGCACAAGTTCTTCTAAAAGAACGTTTTTTAAATCACA
TATCCATCTTAAATCCATATGCTTTTTTACGTCTTATTTACTTACTAAAC
TTTTTTCTATTTTCTATATCTAAAGTTACTGTAGAAAAGCTTGAAGCACC
TTCTAAAAATATCACTAGTTCATTAATCAATGTCTAAGCTGAACAACTAT
TGAAATGATTGAAATAATGCAGGTATACAGTTTTTTCCACATGTAACTTA
AATTTGAATCTCCATTGGTGATCTCCAAGTTTGAGCACTTCGCATTACCA
TTGGTCGTAAAAGCTTAATACTTAATATTTCGGTCTTATTCAAACATTTT
CACCTTTTAGCTTGGATGTCAAACGTGCCGTGCCAAAGATCGATGCTTCC
ATTTGCTCCTCATTTCTGGGAATAAGTTCCACGGTGGGGTGCGGATCGGA
TCGTTGGCAACTGGACGGATTTCATGGAGAACATCAAGGCACTAAGAGCT
TTGTGTTGGATTTGGGTTTGGAATAAGTATGCAGATACATTCGTGCATTC
AATTTGTTGTCATAGAGATTGATGTAATGACAAATTTATTACATTATATT
CGTGATACAGCAACAAGGCGCTCATCTGGTTTAAAACTCAATTGAAAAGG
GGTAGTACTTGTGGTTGAGGCCCTTAATCAAATTTAATGGCACCACCCGT
TCGCCAGTGTGATAACCATCGAGAACGGCCATTTCCTCGGCTGTCAGCTC
AAAATCGAAGATATCGAAGTTCTCAGAAATTCGGTTAGTATTCGATGACT
TTGGAATGGGAATGACACCCAGACCAACCTGCGAAAAGAGAGATTTTAAT
TAGATGCTGTCGCTGAGGTCAGGTTGATGCCTCAATTACCAGGTAACGCA
GCACAATCTGCGGTGTAGTCTTGCCATATTTTTTGGCAATAACAGCCACC
TCCGGCGAATAGATAAAGTCCGGCTTCTGAATATCCGGCTTGGGCTTTCC
CAAAGGCGTGTAGCCCGTCAAGGTGACGTCGTTCTTCTTGCAGAAGGCTG
TCAAAGCCTTCTGGTTGAGCGCAGGCGAGCACTCCACCTGGTTAGTGACG
GGTTTGATCTCGCAGTTGGCCAAAACTCGTGCCAGCTGCTCGCTGTTGAA
GTTGGATACTCCGATGCTGCGCACCAGGCCCAGTTTTACCAGCTTTTCCA
TGGCTTTGTACGTATCCAGATAGTCGACATCGCTCAGTTGGAGCACATCG
TCCTCATTTTTGGGCAGCAGGGTGTTGTCATCTACATATTTGTAGCCCAC
TGGCATATGCATCAGATACAGATCGATATAGTCCAAGCCAAAATTGCTTA
ACTGCTTGCGGCAAATGCCCTCAACGCGCTCTGGATCGTGGAAAATGTTC
CAAAGCTGCGCAAAAATATAATCTTATTGATAGATCTAGAACATATCATC
ATGGCATTTACCTTAGTGACCAAAAATATATCCTCTCGCTTGACCACACC
TTCTGCGATCTTGTCCCGAATCGCCTTGCCCACTTCGGCCTCGTTTTGGT
AGAAATAGGCCGTATCTATATGACGATAGCCCACATCAATCGCATGTTTC
ACAGCGGCTTCGCCTTCGTTGTCCTTCGACTGCAAATAGAGAATATCAAA
TTCATCATTAACCTTTCTCCTTTCTGACAGAATCAAATATGTGTTTTATA
ATGCGACTCTTGAGATCAGTATATTGTTATTTTCGACCACAGCAACACGT
TCGTTTCGGCCAGGAAATTGTGAGCATATCGGAGAGCCGCGAATTGACAA
ATCGAAACAATATCCGAAATTATACAACTGATCAACGTCGCAAGGCACAC
GAAAGATTCGATAAACTTTGATAGAGACATTTAGAGAGATACAAATAATT
ATTTCCCCAGGTGAGCACTTAAAATGTTAATAGGATCATATCTAGCACAA
AATATAGTATATTTATATATGATAACGATTGATATGATGACATTTTATAA
CATTGTAATATTGTACTAAAAAAAAACTAACGTAAAAACTAAACTATCTA
ACGAGATTCTATCTTATACATTTACATAGTTACACTTTTTTTCCGAACAC
TAAATATCTCTTGCTAGTACGGATAGTACTGATGATTCTTCGCTTTATCG
AATTTCCAGATTCTGCGCCCTGTATTAAAGGTCTTCATTTGGAGCAACTC
CTCCGGCGTTAGGTGGAAATCAAATATATCCAGATTCTCTACGAGATGGG
CTCGCTGGGCAGCTTTTGGAATAGGTACCGTGCCAATATCGATCTGTAGA
TTTTTAGCCAATAAATATCTTTATCACTTTACAATTCTAAGGTCGTTTAT
ACCAAGTATCTTAGGATGATTTGAGCTGGTGTCTTGCCGTATTTCGCTGC
CAACGCCAGTAGCTTGGAATCAGTGTAGTAATCGGGCAGCGGATTGCAGG
CTTTGGGACGCCCCAGTGGCGAATAGGCAACCACGGTGATATTGTGAAAT
TTACAGAGCTCAATTAATGGGACTTGCACCAATTCCGGATGACATTCTAT
TTGTAGGTTTGCCGGCTTGATTTGGCAGTTTTCCAGTAATCTCTTCAGCT
GATTGGCATTAAAGTTGGACAATCCCAAGCTGCGCACCAGCCCCAGATGC
ACCAGTTGCTCCATACTTCTGTAGGTGTCCACATAGTCCACATCGCTATA
AGTTCCAAAGATCAGTTTCTTTAAGCTTCTTGAATCTAAACTATGTATGT
TTAGTTGTATCCCAAACTCACTTGGTCCTCAGCTGGCCATTCTCGTGGGG
CATCAGATCTTCATCAGAGATGTAGTCCACGCCCACCGGCGAATGCATCA
GATATAGATCTATATAGTCCACGCCCAGTAGCTTTAATTGCATATCACAG
GCGTATTTCACCATCTTGGGTTCGTGGTATATGTCCCACAGCTAATTGGA
TATTGATTTTCGATCTATTTACATGTGCTGGTAACTATATATAACCCATC
TGTACTATATCCTACCTTTGTGACCAGAAACACCTGTTCGCGTTTCAGTT
TCTGGTCGCCAATAAGTTTAGCTAAAACCTTGCCTATAATGCCTTCATTC
CTGTACAGATATGCGGTGTCTATATGCCGATAGCCCATTTCGAGGGCGTG
GCACACGGCAGCCTCACAGCGAGACTTCTTTAACTACAGATAACATAATT
AACTTTCAATTTCACAATTGCACTTAATTGGAATTGAATGGTAGAAATTT
CCATAAACAATTTCTGCCTGCTGATTTATTAGCATCGCCGATGATAAGGA
CTTACATTGTAGGTTCCTAGGCCCAGAATTGGCATCTCGTAGCCATTGTT
TAGCTTAACAGTCGGAGCGAGCTTCATTTTGCACGTTTAAATCAAGAATA
AATAAGGAAATTCAATCGCTTAATAAAAAAAAAGCCGGTGAGCATAGTGT
GACCAAAACGGCTTTGCGTAAAAATACCCAATGCCATTCTGCTAAGCTTT
ATTATTTAAATATTTTTAAGTGTTTAAATAGCTAAAGAAACTTTGATTTA
TATTAAATAGGAACAAATGTTGTCATAAAACAGTGTTAATTTTATGTTAA
AAAGTAAAATGTTCAAATTTAATTACGGCAGTGCTTTTGCATTTTGGCAG
CTTGCAGCACTGGTTTATAACTAGTACTTAAACAGCTGTTACGAAAATAT
CTTTTTTTTTAAGAAATCTAAACAAAAGAACTTTTAAAATAGATGGAAAC
ATGAGATCCATTTGAAAACGTAAATAAAAATAGAAAAAACTAAAACTGCC
AGCAAACGCACACAAAGCAGAGTTCAAGTTGTCGCAAAGAAACCTTGAGA
CCTTGAAAAGCAAGTAAACAAATCAATTTTTGTGTTCTCCCTTATTATAA
ACAAATAAATTCTAGGCTACAATGAGCCACTTGGGCCTTGCGGATGTGCA
CCAGTCCGAGGATGCCACTCCTGACCTGGAATCCTTCACTGGCTTCGGCA
ACTCCGCCGCCGAGGCCTTCATTCAAAGTCTCGCAGGAATGGTGAATCAG
GGCGATGTGGAGACCATGATACGGGCTCAAAAGCAAATGTAAGCCATTTC
ATTTAACCAGAGATTATAATAAACATCCAAAATATATCCCACAGGCTGCA
ACGCTTTGAGAAAACCAACGAGATGCTGCTCAACTGCAATGCCTTATCGC
AGAGTCGTTTGAAAAGTGCCAGCGAGGATTTCAAAAGACACGTGAAATGC
CTGAGCGAAATGAAGAAGGATCTGGATTACATATTCCGCAAGATACGGAT
CATCAAGCAGAAGCTACAGTCGCAGTTTCCCGCCATTTACGCCGAAGTTC
AGCCGCAGCGTAGCAGTTTGGCTGAGGAAGCCGAGGATGATACGGAAGCC
CAGGCTAAAAAGACTGCAGAAACACCTGCTCCTGCTGCCGCAAAACCTGT
CCTATCCACCAAGAAAAGTGCCGCCACCATAGAGTACGTGCAGATGGAGG
AGGCAGTGGACAATGGCACTGTGGAGATCGAAAACGAGCTGATCAAGCGA
GTTTGTTCCGTGGAAACTGCCAATCCCAATGATTCCTCCGACTGCACATC
CGAGGATACAGGTTAAGCCTAATTAGCTTTAGTCCCTCGATATATTTATC
TTCATATAATAACTTATTGGTTTAATATTTGTATAACCTGCTACTACATA
CAAGGACACAATTCGTTTAGTTAGATTTAAATGAAATATGCGTAATAATT
TAAGAAACTAATGGCTTAAAATATAATCTGGTACTTGTACTGCTTGGGCA
CCTTTGAGATTATGACGCGACCATCGTAGCTGAGCGAAGCAAAGATCCAC
GGATCCACATTGCTCCACTCCGCGCAGTAAACGGAGTCCTCGTGCTGATC
GAAGGTCTGCAGCAGACCATCTGGCAAGAGTTTGTGCCTCTCCTCGGCAT
CGGCACCACTGAAGTTGGACTCATCTAGTCCAGCCTGAACCTGCGTCTCC
GAACTAACCGATCCCGCACACGTGAGCAGCACCTTGCAGTCACTGGAGCT
GGAGAGGATCAGTTGGTCGTGGAATGTGTTGAAGCGAACGCACCAGACCC
AATGCGAATGATCGGAGCGCTCGAAAACGGGAGCCTTGGGCATGCGACAG
TCCCAGATCCTCAAGTAGCCATCGTCACCGCCGGTGACCAAATGGCACTG
CTTGTTGGGATTGCAGTCCAGGTCACGGACCATTTGACCATGCGCATCGT
TGATGCTCCAGGCACAATGCTGTGTATCCCGCACATCGTAGGCACTTAGA
TTGCCATCCTGGAGGGTGAGAAACTGGTGGCCCTGATGATGATGCGACCA
CTTGCCGCTGGTGAAATGCTGTGTGTGCTTTGCAGATCCACTGGATGAAC
CACTGGCCGGCACCTCGGCCACCACGCGAGTAGAGGACTCGGCCCGCTGC
ATCACAGCCACCTTGTTGTCCACCACACAGGCGAGTGTGTCCTGGTTGGG
ATGGAATTCGATGGTCTTCACACGTTCGCCCAGTGCTTCGGTATCCAGGA
CCTCAACCTGCTCCCACGGCAGGTACTCTGACTTCAGCTGCTCCGGATCG
GGATTGAGATTCTCGGGCAGCGTAAACAGAGCCGCTTTGGTCAGCACTTG
TGCTCCCTTTTGTACATTGTAGACGGAGGCCAGCAGGCGAGGATTACGCG
GACAACTATTTAGTTTCCAAACTTCACCCAGGGCGTGCTCAAAGACCTGT
TCAAAGTTGTATGTTTAGCTCATACTTTGATCATCCCAGATATTCACCTT
TGATTGCACGGATCCCTGCTCCTCCTCGTACTGGATTAAGTGAACCTGAT
TGGTGGGCTTCAAGGAGTTGGTGGCTATGAAGAAGCACACATCGTTGCTC
TCTCCGTACTGAGGTGTTAAAGCCCGCGCCTGCAGTTCGAGTCCGTAGAT
TAAGCTATTTTCATCCATTTTCCACGATTTACTCAATGTTTTGATTTCGC
TGGATATCTAGGTACGCAACTTACGTACACTAAACGGCGTACCTAAAAGT
GTTGGTAAGCATTTATCACAAGGTGGCAGCCCTCGATCATATTACAAAAC
AATATATAATTTATTTTAATAAAATTAAAATATTTACATATATAAAGAGG
CTTAAATATATGTGATTTAATATATTAAGCTCAAAATATAAAATAAATAA
TATTGGTATTCAAAATCCATTGATATAATTTGGTTACACTTAACGTTATG
CCTTTTAAACGTGTAATAATTATACATACTTGGAATAGTAAGCTAATTAT
AGTATTAAGCTTAATACGTTTATAATCTTTACTTACCTTTGAAACATTTT
CCGTTATCTCTCGGCCAGTGTGACCGTTCGACCACGCCAAGAGAGCGTAT
CGACTCCCCCCAAAAATAAATGAAATACAACCCTGTGCCCAAACACAGTT
TCTTCTCGTTCTCCTTCCATTTTGTTTTCACACAAAAGTGAAAAAAAAAA
TATCTGAAAAAGCAACAGACGCGTATTCCGACCGATCAAACTAAATTTCC
ACTATACAGTACATATAATCACAATTGAGAATCGAAAACCCGACCGCCAC
GAAGCGCGCTAAATTACACGCACATACTGAAAGCCAAACAGCGGATAGCA
CTAGCATCCTACATATATAGACGTAGATATATAGTCATGGCGCAGAATAT
CAGCCCCGAGCAAAGTGGTGGAGCAGGCGGCGGCGGCAGCAAGCACAGCG
ATGACTCCATGCCCGTGAAAGACAATCACGCCGTGAGCAAAAGGTGAGTA
GCACATGGTGCAGCCTAGATAATCCGCCAATATACACACACACTCACACT
CACCCACAGACTGCACAAGGAACTGATGAACCTGATGATGGCCAACGAGA
GGGGCATCTCAGCGTTTCCGGACGGCGAGAACATCTTCAAGTGGGTGGGC
ACCATAGCGGGTCCACGGAACACGGTGTATTCGGGGCAAACGTATCGTTT
GTCACTGGATTTTCCCAATTCCTATCCGTATGCAGCACCCGTGGTGAAGT
TCCTGACGTCCTGCTTCCATCCCAATGTTGATCTGCAGGGCGCCATCTGT
TTGGACATACTGAAGGACAAATGGTCGGCCCTGTACGATGTGCGCACCAT
TCTGCTGTCCATACAATCCCTGCTGGGCGAACCGAACAACGAGAGTCCAC
TGAATGCGCAGGCCGCGATGATGTGGAATGACCAAAAGGAGTACAAAAAA
TATCTAGACGCCTTCTACGAGAAGCACAAGGACACCTAGAGTTTGGCAAT
TCGTTGTCATATATCCTATGCTCATATTGCGGCGTATTTATTTACATATA
GTGCAAGCAACTCCACTCATCCGAAGACCTACTGCCAACCAACAAACCAA
TCATCAATCACCACCGTAACACAGTACCATCAGTTAAGTGGATCACCAGA
TCAATTTCAACAACGTTCAATGCTGATAGTTCATTTGGCAAAAGACCCCG
TGCGTTTCTTATGTAATTGTCGATCGATTGACGGATAATCTGGTTTTTAT
TCTCATTTCTTTCCTCCTCCCTACAAATTAATGATAAATGAATGTATTGG
TAATGTAATTTTAAAACTGTCATCCGTTCTTTAAGCTTAAGGATAAATTT
TAGTTAATTGTTTTATATACGCATGATTACTTTTTTGAGAACTACTGCGA
GTGCGCGCCATCGCCATCGCCATTTTTTTGTACTGATGATTTTTAAGCGA
CTATGCTGCTGCGCCGGCCATTATGTGAATGTTAGCTAATTTTAGGGCAG
CCTCATCGATTCGTCAACCATTCGCGTCGTCTTAGTATCTCCAATTATGC
GGCATTCTCCCACAATACTGGCATAACAAAATTCCAAGTAATTCGAATCA
TTGTAACAGTTGTGTTAGCTTGATGTTATTGAAACCACAAATAAAACGAA
TTATTGAACTACATCCATCGCTTTGTGTTTCCTCCCGTGAGCGTTGAGCT
CCACGCTGTTCTGGAAAATGCGTCCGCATTTTCTGCATCTGAGCAGCAGA
TTCTTATTGCCGTGCTTGCGCAGCAGATGATCCACCATGTTCTCCTTGGT
GTAGAATCTGCGATCGCAGCATTCGCAGCAGTATCTCCGACCCTCAACGC
TACCATGGACCATCTTGTGGCGCGTTAGATGTGCCTTTCGCGCAAAGCAC
TTGCCACACTCCTCACAAATGTGCCGCGCATCCGGGGACTCTGACTCGTG
ATACCTTTCGTGCGTCCTTCTCATGTGATATTTGAGACTTCGGTTCGCTG
TGTACACCTTGTTGCAGCTCGGACAGGCATAGATGATCCGCGCAGCGTCG
GCATTGTTATGCATCTGCCGCAGGTGCGACTCCAGCAGATTGGCCCGGGC
ATAGCTCTTGGCACAATGGACGCAGGTATACGGTCTCAGACCCTCATGCT
GCTGCATATGGGCCTCCAGCAGCGACGGTTTGTAGAAGCCACGGTGGCAA
ATTCGGCACTCGAGGGTGTGTCGCACTCCTCGTCGTTTTCTGGCACCCAG
CAACTTGCTAGAAATGGATAGCTTCTCCTGGCCCAGATCCTGTTTGGCTG
ACTCGTCCTCTATTACGTAGACTTCCTCCTGGAAAATTTAGGGTATTATA
TATTTAATTACCATAGCAAACTGAATGGTGGTGGTTTTTTTTTTTTTTTG
TGGGAATTCTGTACATATCTATTATGAAGGAATTTTTTATGTAAAAAGGG
TCTAAGCATATAAAAACAAACTGCTTTTGGTTGAGTTAAGTAATTTGTAG
TAAGGGTAGGAATTACATTATGTTTACTCATTACTTTAAAGTGGAAATTT
TTCCTTAATTTGCTATTAAGATTATCTTATCGCTCGACTTAGAAGATGAT
AAAATGAAAGTAATATTTTGTGAACCGAACTTTTGGCGGTCACTTATCTG
TTTAGTTTAGTTTTTTAATGCTAAAAATATTAAAGGCGCTATAAATAATA
TCTAAAATGAGTGAAAGTTAGGGAACACATTTATCTATTCTAGATAAAAC
TGGCCTTTAAAATCGACTTTCTTATTTGGAGGAGCCATAAATCGAGGCGT
GTTGCCATCTTCCCAATTTTATTAGTGGAAAATTTAAAAATACCCAATAG
ATTGGGACGTGCCTCCTTTTCGAGTGCTATCACCCACCAAACAAAAATAG
TACAACACAAACAAACGCTGTCGAAATGTTTTTGTTTATGGCGGGGAATG
GGGAGCAGTATTGTCTTTGCTTGGCTGCTAGGCAACACACCTCGAGCGAA
GCACCCAATGTGATTCTAGATAAGATTACGGCCAGAGGCAGGCACACTTG
TGGCCAGATAAAACTCACAATCTCCTGCGTCGCTGCGATGCAGGGTGCGT
GCGACTGGGCTTCCGGATTAGTGGACTCGTTGCTCTCCGAGGGGGTGTCC
AAGTCGTGCCAAGTGTGGTCCTCCAGTTTGTGGCATCCGATGTCGATGTC
CTGCAGCAGCTTCTCAAAATTGCGCAAGGACTCTGCGCACATGCGTTGAA
AGTCGTGGAACTTTTGCACCAACTGATAGCAGCACTCGCAGATGCTTTTC
AGCACCAACTGGGGTGGCAAATCCCTAACGGCATCCTCTCCAGTACAGCC
GTAGTACTTGCTGGCCAGATCCTGTTCGCTGTCCAGATTGTGACACGCAT
CCTGCGGACCCAGTAGCACAAGACAAGCGCGGCATATCATCGTCTTGGCA
CCATCGCATCCATCCATGCCGGAGGTAGTGGTGGTGGTGGAATCGGCGAC
AATGCGACCCGCGCACAAACTCAGCTGGGAATCAAACATCGTTGCTGGCA
TCGTCGGGAGATTCAACGGGCCACTCAAATGGCGTGGAGCCAATTGAAAT
CAATTAACACAATCTGCGACGGCGGCAGTGCAGCAGTCCGGCGTCCAGCG
GCCAAGCCAACGATGGCAGTAATGCCAGCGGAGAGCACGATTCCATTTCC
GGGGCTTTCGAATTGCGGGACATTGAAAGCTGCTGCCGAAAAGCTGCGTG
GGATCAGCCCCAAAAGCTTGGCGTCGACTCCATGCCCCCAACTATTCTAT
TCGAAAAGCTATCCTGCATAGTAAAATTGATTTAAAATATTATGCGACTT
CTTTAATTAATTAAAAAATATTTCCTTTAATATGCTTCGATATTTTAGTG
ATCAAAATAAATATATTAATTTAATATGAATTACCTTTTTTATCAAAATC
TCAAGTTTTATTTGTGTATACAGCACAAAGTATTTAAAGAGTAAATTAAG
TAATTTTTAAAAGATTCTGCCATGTGATTTTAGGCAATCGTTACACATGA
AAAAGATTGTGAAAAAACATATGTTCTGACAAGTTAAAATAATAATAATC
CAAATGTATAGCATATCCTAACCCTAGATATAACTACAACTACTCAGTTT
GTAGTATTTTGCTTTGTCCATTCGTTTAGTTAATATATATCCTTCATCTA
TATGCTATTTCCGGTGACAGTCGAGCCCAAAGTCACAGAAGTGGCCACTG
AAGACAGCGTTTCCATGGAGATATTGAACTTCTGCTTGAATGCCTGCATC
GTGTCCAGATGGTAGATCTTCTGTGTTCCATTGCAGGGCCTCTGATCGAT
GGCCACGGCATAGAGATTGACATCTCCGCTGTTGGCCAGCAGCGTGGACA
TGTAGTGGGGCAAGTAGACGCGCTGCAGTTCCGGGGATTCCGAATTCTCC
GATGCGTTATCCCCGCTGGCCATTTCCTTGCTGAACGACCGATGCAAACG
GACTATCTGCACGCTTTGATAGTGCGATATGAATAGGAATGGATCGCGGT
AAACAAATCCAGTGGGTGCATAGACCCAGTTCAAATCGTACGGCCTGGAT
CTGCAGCCAAACTCGTCCACAAAGACGCCATATTCGGCAAAGCAGAGCAG
ATACTCTTGTCGTGAGATGCGCACCGCAGTTAGGGGCTGGCACTTGGCAG
TGCTCTCCATTGACTTATCGGACAGATCCACAAACTCCTCAGCCGCATAG
TTGTCCAAATCGATCTCGTAGAACTTATCCGAGCTAACAATGGCCGAGTG
ACGCGTAAAGAATATGGATGTGACCGGCGTGGCCGTGTCCAAGGCTCGAA
CTGGCTTAAACATGTGCAGCTTAAGGTCGTACTTCAAGATGACAATCCTA
GTGGACGTGGCCGCAATAGCCACCGAATCCAATGCGTTCTCCGCCTCATC
GGAGATCAGCACTAGTTTCCATTTCTCCGATGGCGTGCGATTGGCAAATG
GCAGCTCAATGGCCGACGTTTCCAGCACAGGCTTGTGACACGAACTGGAG
CTCTGACAGCGTGACTCCAGCTGGCGGTAGTCACATTGATATAGCTTCTC
GCCAACTGTGCCCACCATTATAGCCTTAGCCAGGCGCTTGCAAATGGACA
TGCAGCTCACCGATTCGAGACCAGAAATGTGCACCAATCGCTGCGAGTCC
AAGTGATACGCATACAGTCCCGTGTTACAGCCCAATAGGAGTATTTGCTG
CTCGGCCACTTCAAAGGCGCAGTTCACTTCGATCTCCTTCCGTGCCTGAT
CTTCTGCACCATCCGAACTGTAGACCAGCGATCCAATGTACTCGCCACCG
CTGGTTGTACCACCCGCAACATCTACGCTATCCAAAGTCAAGCTGGAGAC
AGATTGAATACTGCTAAGATCATCGGCTGACGGTGCAGTCGGCTTGGTGG
ATCCGCAATGGCTCTGAACATTGGAGCGACACTTGCGATGCGTAACATCT
TTGCACTCCTTGCATTTCCAGAACGGCGAACCGGCAACGACGGCCTTTTC
GCAAACTACACAGTTGACGGCATCCACCTTGGACTCCTGCAGGGCCAGTT
CGAAACGGTGATGAGCCTGGTTCTCAATGGTTACTTTAGTCGGTTTCTCC
GCCGTCGTCTTCAGCTCCACCTGGCTGGTGGTGCGCTTCAGGGGCTGCTG
CTGCTTCTGTGGAGAACGTGGCAAGGCAGCAATGCTTACGGGTCTCTGTT
TGGGTGCATCGGAGTCGCCATTAACAGCTGCAGATTTGCGTGGAGAGCGC
AAGGTTGCAGTTCCTAAAGGAAATATACAATTAGATACAAACATCAAGCG
AAATCTAAAGAAATCCCACCATTCAACTGAGCCAACTGCTCCTTCAGCAA
GCTGTTCATCTTTTGTTCTCGCTTCAGTTCCTCCTTTAGAGCGCGATACA
GAATGGAAGATTCCACGTCATTGGGTGACACGTTCTCCTTGTTTGTGTGG
CTAGAACCGAAAAGTTTGTCCGCCAATGTCTTTTTCTTCTTGGCGGATAG
GTCCTCAACTTTGAGCTAAAATATAAATACAAAAATGTTTTTAATCTCAT
TAACTATTCTCTTAAAAAGAATATATATAAACTAGCTATACCTGAAGGTA
GTCAATCAGCTTTTTGTGCTGCGCAAGTGTGGCATTCGATTTAATGTCCC
GCTGCACGTAGAACTGCTCCTTCTCGGCCAAAGTGTCCTGAAGGGAATCG
ATCTCTGCGTGCAAGTTGGCTTGCGCAGACTCCAAGCCCCTTATCTCCGC
CTGAAGATTGCCAACCTCCTCCTTCTTGTGGAACAGCTCGCTGAGAATTC
TAGCATTTTCCTCCTTCAAACTAACCATTTCGCGATTCGAATCCGCAGTT
TGGGCTTCGTAATTGGCATTTTGCCCATCCAAAAGTTCAGCTCTCTCTTG
GGTGGCAAACAGTGCGTTAGTCTGCTCCACCAACTGATCCTGCTGCGCCA
CCAGCTTCTTCTGCTGCTCCTTGAGATTGAGACGAAGTTCATCGATTTCC
GATGCCAACACTTGAGCACGCTGCTCCGCCAGACGCTTTTCCGATTCCAC
CGTAGTTAGTTGCTTTCGTAGATCAGTTAATTGATCGTTGCGCTCTCTGA
GTTTCTCATGAAGGGTATCAAGTTGAGATTTCTGGGATTTATTTCGTTCC
TGCTCCGATTTTAGCATGGTCTCCACCTCAGTTAGCTGGCTGTCGGTAAT
GCTACAAGCGTACTTCAACCTCTGGAAGTTATCGGTGAGTTGTTTCAGCT
CCTTCTGTAAGACCAAACAAGAGTCATTCGCTTTCCTGCTCTTTTCTCGC
TCCTCCTGCAGTTCTCGAATGGTATTCTTCTGTTCCAAAGTTACACCATC
AAATCGCGATTGGATTTGCCTGAGTTTCTGGCGCAATTCCGTCTCCTGTT
GTTCTAATCTGTGCACATTGGCCAAGTGCTCGATTATCTCCGACTTGCAC
TTCATGCGCTCCTGCTCGGCCTTTTCCCATTGGCGGTGCTCCTTGAGGAC
ATCCCTTTTGGCGGCCGCCAGTTCCTGCTTCAGCTCCTCGATGCGAGACT
CCCGCTGGCGAGTTTCCTCCTGTGACGTCTTGAGCATTCTCTGCGCTTCA
TCGCTTGCGTTCTGCACCTTTTTAATCCGATCCTCTGTGAGTTCCATGCG
ACGCGCCAGTAACTTCTTCTCGGACAAAGCTTCCTCGAGCTGTTTCTCCA
CCTTCCAGAGCGATAGATTCGCTGTACGCGCTGCCTGACGTTCCACAATC
ATCTGCTCTCGCACTGCTGCCAATTTATCCTCCAGCTTCTCGTTTTGCCG
CTCGAGCATATCACCAACGGTTTCACCTTCTTGCTTACGCGATGAGTGCG
ATTTCGTGGGTGAAAGACTCTGCTCGTTGAAGCGCTCCAGCATTTGCTCC
AGTTTGGTAACCAGCGTCTGCAGTTGATCGGCGCGTCCCTTCTGATGGTT
TTCACTCTCTTTGGCGGCTAACAAGTCGGCGCGAAGTTGATCCTCAATGG
CATTCAGTTCGGTCAAAGATCCAGGCGCAGTTTCGTAGGGGGAAACCTGG
GTGGCTAGTGAGGATTCAGCCAGCTGACAGCGACATTCGGCAAGCTAGTT
TAAATTAATTCATAAAGTATATTTACAAATTACATATCTTTAGGTTTCTA
TATTCATCGATTCAATCGAAAGCTATATGCTTCATTAAAAATCATTAAGA
CTTTAAGTTTGACACAAAATAAAAACACAAACATTCACAGCCTGCTAAGA
TTTCTTTTTATATAATTTTTTTTTACTCAATATTGCAGTGATTGAATTAA
CCAATGCAGATGAATAACCACCTACCTGCAATTCCCTCTCAAGTCGATGA
CATTCGGCTCTAACTTCTTGAGTTTCATTTTCCTTCAGCTGCAGCTTCGT
CTCCAGTTTGACCTTTTCCGCATGAAGCTCATTATTGGAGGCGATCTCCT
CGTTCAGACGCCGCAGAATTTCTTCGATATTCCGCTCGGTAGCGTTCTTC
GCTTCTTGGGTGGACTTGCTGGAGGATATGGACTCGTCCAGCTCGGTGCG
TATTTCCTTTATCTCCATTGTCATGCGGCGGTTTGTATCCTGCGAGTCGC
GAACCTTTTTCCGGAGATCTGTTAGCTTTTGCTCATACAATTCGGCCATT
TGGCGCCTCTGCTCCTCATGGTTTGTCTCGGACTTGAGATTCTGCTCCTT
GATCTGCTGCAGCATATCCTTGTAGTTTTGCAACTTCATGGACAAATGCT
TGCACTCTTCGAACTTGGCATTGAACTCCAACTCACGGGCATCTAACTTT
TGCAGCGTGGATGCCAGCTCTTGCTTTTTGTCCGCCAATTGTTTCTCATA
TCGTTGCTCCGAAGCGATCTTGGCTTCTTCGTACTTTTGTCGATTAAGGC
GAAGGAGATCGGTGATAGTGGCTTCCTTCTTGGACCACATTTCCTCGTCT
ATTTTGGCCGAACTTTGGAGTGTCTTAATTTGCGTCTTGCAAGTGGTAAG
CTCCATTGTTTTCTCCTTGATAATCTGTTGCAGCTTCTTAATTTCCATTT
TAGCATCGGCTACCACCTGAGATTTGTTATCGGTCTTCCTCAGCGATTGC
TGAGCCCGCAGAAGATCTTGTTTCAGCATGGAAATCTCGTTCTCTCTAGT
CTTCAGTTTCTGCAGCAGTTCCTTTAGCTTCTCCTGAAGCTTTTCATCGG
TGGTAGCGGAAATTGCCGACTTTTCCATGTGCACAAAACTGTACCCAATG
AATGGCAGATCCTTGCCACTGAAATCATTCGATTTCATGTTAGTCGTAAG
GGACTTTTTAGCAACTCCCTGTTCTCTGCGAGTCTTATGACGAATTCCGT
CCTCGAAATTGGAGGTATCATCGTCAGACCTAACAGTTGGTATAATCGGT
GGAACCTGCGAGCGAATGGAACCCCACGGAATTTCGCTAAAGAAGGGGTG
ATTCTTAATGCGCTCATAGGACAATCGCTTCGAAGGATTTGTGACCAGTG
ACTCAATAAGATTTCTATAGTTAACAGACACCTTCAAGTCGGCGGGAAAG
CTGATGAGCTCTTTAAGGTGACTCTCCTCGCAATGGGAGAGAATCTTGGA
GTATGTCTCGTGTACATTGTCCTCGTGAAAAGGTGTTGTCTCGCATATTA
ACTCATATCCTATAATGCCCATGGACCAATAATCGCAGCTGACCTACAAA
ATGAGTTCTTGTTTTAGCTATGAACTTTCCAAACCAAACTCTGCGATCGT
ACAATTCTACTCACATCGTGCATCGACTTGGACAGCTTGTAGGTGGATAT
GGTTTGCAGCAGCTCTGGAGCTATGTAATCCGGTGTTCCCACCGGCGACA
AACTCAGCACATGGCCATCGCGATCCAAGGCAGCGGCATTACCGAAATCA
GCCAGTTTAATATGGCCAAAACGATCAATCAGTATATTTTCAGGCTTTAT
ATCCCGATGCACATAGCCCATCTCGTGCAATGTGTGCAGGGCCACTGTGA
GCTCGGCCAGATAGAAACGAGCCAAGTCCTCATCGAAAGGGCCGTGGCGT
GACATCAAGCTGAGAAGGTCTCCGCCGGGCATGTACTCCATGACCAGGTA
CAGATTGTCGTTATCCTAAGTGATAAGTTAATTCAAGTACTGAAATATGC
GAAAATGTGGAAATAACAAACCTGAAAGGCATACTGCAGATTGATTAGCC
ATTCAGAGTTGCGAATGGACATGATATCGCGCTCCTCCTTGACTTGTGAC
GTCGTCACCACCGACTTTTTGATCTTCTTCATGGCGTATATGTCGTTGGT
TTGCCGCTCCACCACCAGGTGAACGTTGCCAAAGTATCCTTGGCCAATAA
GCGTCTTGATGAGGAAGTCATCTGCGTTGACCCTGAGTTTGCGGGTCTCC
TCTATGATGGGACGAACTGGAGTAGGAAATTAGATAGTAATATAATGGGT
AACTAGGCATGAGCTCTATTTTCAAGGAGGGAAACCGGAACATACAGGTA
AATCTATAAGAGATTCTACTCCCAATAATTTTGTGGGCTTTAATAATGGA
ATATGATTAGCAAAAGTAGATTCTCTGACCCGAGGAAGTAAAAATGTGGC
TTCTGAGTTCCATTTCTATAGAATGGTAGATACTCCATCCGAAAACCCTG
CTGACCAATGCAGTTGACTCACATTTGTTGACAAACTCGGCGATGTTGCG
ATCGCGCTTCTTCAGCGTATCCTTGTCGCACTCGTTGTACAGCAGACAGA
AGGCGTCCAGGAGTCCCTCGCGGCAGATGGCCTCGGCCACGGCGGCGCTA
GTGGTGCTCACGGGTACAATGCTTCTCCTGGTGGAGGCGGGAATACCTGA
TCCGGAGGCGCTTCCAGCGGGCTTCGCACAGACGCCAGCTCCTTTGCCCA
GAATCAGGTTGTTCAGACGCGCGGTGCGCACGCTAATCGGCTCCATCTTG
GGTGGCATGATGGACTCACTTTTATTTGCAATTTTCTCACATAAATAATA
CAATTAGAAATCCGTAAAATGCCAGAGCATTTTTCTGCCGTTTCGCTTTG
AAAAAAATGCGCCGAGGGAAGCCGAAGAGCCAGGGATGCGTGCTCACTTT
CCAGAGTTGTATTTAGGGTTGCAAGTAGGGCTGCCCTGTGAAAGAGGATA
AAATTTGAATTTTAATGCAAACAGAGAACGGATAAATAATGAAATAGTCT
TATTTACTTTTGGCAACCTTTTGAAGCGTCCCCTTTTATATTTTGCACAG
TTTTGCACATAAACAGTTATTATTATTATTTCGCTGCCGCCGCCGCTGCT
ATACAACCGCGCTTTCCAACACCGTCGAGGCTCTCGCTCGTATGCATCGT
TCATTTTCGACGGGTAGGTTTTCGCAGACGGACGGAGCAAAGATTTGTGC
ATCGAAAATTGCAATTTTCACATTTGGAGCCGTGTGTGCAGCATCACAGA
CATTGGAAAAGCGCTTGTCGCACTTGTGCAAAAACACAGCTTGATAAAGC
AAACGCGGCTAGAAGGCGATTGGCCGCAAATTCGCCCTGGAACTGGAACG
CAATTGCGTGTGAAAAAAAGACGGAAAAAAAGTAAAAGAGCAGAGACTGA
AACCGTCGAGAAATCGTTGTCGTCGCGCTCGCTATAATTGTTTGCTTTTG
ACAGAGAAATTCGTGTGCCTGTTGGCAGAAACATTTAATAATAGTTTGTA
TTTTCGGCGTGAGTGCGCAGTGAAGCATCGAAGTAGTTCAAGATGAGCGG
GGGATTACCGGAGTTGGGCTCCAAAATCAGCCTCATTTCCAAGGCGGACA
TTCGATACGAGGGCCGCCTGTACACGGTGGATC