P[acman] BAC CH321-48H18

CH321-48H18 is on chromosome arm chrX from 7821811 to 7909811.

BACPAC Resources is the distributor of clones for this project. Investigators requesting a clone will need to establish an account with them. They will also respond to all questions regarding shipment and availability.

Return to the Browser

The sequence for the BAC is deduced by extracting the sequence from the reference genome based on the alignment of one end of the BAC and the estimated location of the other end based on mean insert size from the library. The sequence of the BAC has not been confirmed over its full length, nor has the sequence been aligned to the MboI restriction sites (GATC) used in the BAC library construction.

>CH321-48H18 88001bp
GATCTTATCGGTCACAGTGAAAAAAGTACTGAACTCCATTTTGGAAAGAT
ATATAGTGTATTCCTTTAGGCAGTTAATGCAAAATTGGAAAACTTGAAAG
TAGAGTGTTTGCAATTTGGAAATTCCCTTTCTTCACAATTTAATTGTAAA
AGGGTCTTTAATCTTTTTAACTACACTTCTTTAGCAAACTTGCTATTCAT
TTTTTCACTGTGCACTCGGAATCGACCCCGTTTCCGCTCCTTTCCGGCAT
GTTTTTCCATGGCAACCGACTCACCTGCCCACTCGCCCATTTTGGAGAGA
TCCACCGAGGAGCCAAAGACCTTGGGGCCAACAACATTGGCGTAAATCCA
GGGCAGGACCTTCCGGAAGACCTGGAAGCCCACGATTCCGATGGCCAGAC
CGCCCAGCAGGCTCAGCACTTGCGAGTTGTTCTCCTCCATGATGTTGATG
ATGGAGATTAGTGGTTCCTGGTTCCTGGTACTCCTAGGCAATGGTACCTA
TTGTATGTACTATATGGTGCGATTGCGATCGGTCGACTGCTATAGCCTCT
GCCGGCTGATTAGTTTCTGATTCTACGATTTTCGAGCTGCAATGCCGAAA
TGGAAATGCTGACGCCGCTGCTTTTTTTTCGCCTCTGCCGACTGCGCTGC
CTTTTCGAACTGTATTTGTGGTGTGTTGTAGTAATTCTACACACACACAC
ACCCTTCGAAATCGCCACTGATTTTCGATTACTCGATTTATGTACGCGTG
TTTTTTGCCTGATTTGTATTCCAAATGCGTTTTCTTTGAAAGGAGAAACT
TAGGGTAGAAGGGGGAAAATAAAAACAAATGGAAAAAGCGATTGAATGTC
AATTGTCAACGGCACAAAAGCAAATGAACGGTTCTTTTTCGTATCCATGT
GCCCCCCTCAGAGGGGTGTGTGTCTGTGTTGTGTGCCCACTTATGTCATT
TCATAGCGCTCACGCACACCACCAAAAAGCGAAAGATAAGGGCGGCTGCA
AACAGTGAGCGCAAAAATTTATCACACCAAGAACCGTTATGTTGCACTAG
CTGATTTTAAAAGAGGGATGAAATGTAAATTCAGCAATAGTTTTCCGCCT
AAGGGTTCACAGGTTCATTACCGTATATCCTTCTTTTACTAGTCTATTAA
TTAGTTTATTTAAAAGCGAAAAAAGCATGCATATGTATATCATAGGAGGG
CAGTGTAAGTTCTATGCTCTCACCAATACACGCCAGAATGGGGCAATCAC
CGAAATAGTCTGACTAATTTCCTGCACATGCGCAGGAAGCAGAAAGTGCG
ATAAACAATTTAACGCAGCGAATGCTACAATTAAAGTCGTTAAATATTTT
TGATGTTTCTGAGTAAAGCCCGCTATATTAACGGTAAATTATTGATGGAG
CGAGATGGCTATAGCGGATCGCGTATGTGCGAGGGTAATCCTTTGCCTAT
CGATAAATATCGGTTACTTATCGAATTTCGAATTTGAAGCTTAATTTGAC
AGTAAAAGAATGGTAGTTTATCTGTATTTTTACTCTAGGCTCTTAACAAT
TAGTAAAATACAGGTATTTCTGAGCTCAATCGCCCGATTTATTTGCATGC
CGAGCTATACGGATTCAAAGGACCTTGTTTGGTGGGTAGAAATCCCTGGA
TTGCAAGAATGCCGAGAGAGATGCTGGCCTTTCGGAGCGGATTCAGTGCC
GAAGCAAGTGTGGGTGAGGGAACAACAACGCCGAAGGACCGGCAAAAGCA
ACTTTTATATTGTTAAATATTTATCAGAACCATCCGCCGAAAAGAGCTTT
TTTCCTGGACAAATGCAAACAAAAGAAGAAAAGAAAAGTCTTTTTCTTTT
TAAAACAATCTTGAAGATTGCATTATTTTGAGCTTGAGAGGTGAGTGGCG
TCTGCTATTTGTTGTTGTTGCTCGGGTAGAGGGATTCCTTCGGATGAAAT
AATAGGGATGCGGATGCTGGCCATGCGCAGAGCATGCCCTGACCTACATT
CCCGTTTATTGGCCATCCGAGCAGCAGTTGCAAAAGGATAAATACACACG
CAACACGAGCTGGTTAATAAGCGCTTTTCCGATTTTCCAATTGTCCGACA
TTCCTATCCCTCCAGCCTCCATCCGCGCGCTGAAAAGTGTGCAAAGAAAT
CAACAAAAAAGAGAAAAAGAAAAAGTAAATATACATATATAATCGAAAAG
GACACTCTGAAAAAGAAGATACTTGAGTGCAATATGTCCAGCAATATTTT
GCCGCAGGGCAATCGATAAGCGAAGCGAAGTGAAGTCCGTGGAATCATCG
CTGGCGATGCAGTGGGACGCTGATGCAGTTGGACTTGGATCGATATAGAA
CAGTTTAGAGGGGCGTTCGTTCATATGTGCATATCCTGCGGCGAGTGGCG
CCAGTCGATGCATCATCCCGCATCCTGTTACCGTATCCCGTAAGTCGGCA
TATGAAGACACTCCGCTGCAGTGATGAGATCGAGGCTGTTTTGGATACTG
GCGATTATATACTCCTCACTCCATCACATCGGCTCGGGTTCCACGTCGAC
CACATGTGAGTCTCCACCTCATGCCTTAATCACATTGCAAACTTTTACCC
AACTCAAACTTTGGCACTTTTAAGCTGAAGATTAAGTTCTTTTGTTTACT
TTGCGGATTACCCAAGTGAAAAATGATTATTTTTTTTTATGTAAAACAAT
TATTTTACTACTTAGTGTGCAAGCATTATTCGAAACGAAATTATTGTTTT
ATTTGAGTTTTTCTTTTATACGTGATTTTAGCTGAGTGCATTTTATTTTT
ATATATTATATGATTTTCATATATATTTTAACTATATCTATTGAAATTGT
TTTTTTTCGAACTAGTGAAACGACCGCGAGCTGGCGATCCATTCGACACG
TTTCCGAAGAACTTCTGGCAGGAGTTCTCATCGCCGTTCACCGACACGCC
CGAGGATGAGGAGCTGGAGGTCACCGAGACGACCACCCACGAGCCGTTCC
CGTTCTTCGCCGATCCGTACACCACGCTGAACATCAGCACCCAGCTCTCG
TCCAGCGTTTATCTGCACTGCCGGGTGAACGATCTGCAGGGCAAGACGGT
GTCCTGGATGCGTCGCCGTGGCGATGATCTCACCCTGATAACCTTTGGCC
AGCACACATATAGCGGCGACTCGCGGTATTCGCTGGAGTTCGAGGAGCCC
AACGATTGGAAGCTGCTCATCCAGTTCGCCAACGAGCGGGACGAGGGTCC
CTACGAGTGCCAGGTGTCCTCGCATCCGCCGCTCGTCCTGCTCGTTTACC
TTACTATAATTGGTGAGCAACTGCTGTCGGCTTGCCAAGCAAAACCTGCT
GATCCATGCTGATCTCATTCGTTGTCCATCCGCAGTTCCTCACGTGGAGA
TACTCGACGAGCGGGGCTCGGCCACGCCGGAGAAGTACTACAAGGCTGGC
AGCACCATCGAGCTGCAGTGCGTCATTTCGAAGATTCCGCATCCCTCCTC
CTATATCACCTGGCGGCACGGACCGCGCCTGCTCAACTACGATACTAGTC
GCGGAGGAATCAGGTAGGATTTGTCGTATATGGTCTTAATAATCGTAAGT
TAATTACCATGCATTTGATATCATTTGCAGTGTCAAGACGGACATGCTGC
CAGGACGAGCTCTGAGTCGCCTGTATATCGCCAATGCCAATCGCCAGGAC
ACGGGCAACTACACCTGCATGCTGGGCAATGAGATTACGGAGACGGTGGT
GGTGCATGTGCTGAACGGTAAGTGTGCAAACTCCCCTTGGCTATTCATAT
AGAATCCGGAATTCCAGGTGAGGAGCCAGCCGCCATGCAGCATGCGAACG
GAAGCCGCCAAAAGGCCAACGCCTCCACAATGGTTGTGTTATTTCTAGTG
TACGTTTGCATCTCCGGTTCGATTTCCGTAGCCGGAATGAATCGGGGATT
GGGCTTGGGACAAGTGTGGGGATGGGGATGGGAATTAAGACGATGACGAC
GCAGCCTAATCCGGGGATCGTAGATCCTAGATTGTGTCGCGGGAAATGCA
TATACCAAAAGAGTCTTGTCCAGGATTGCATTTTCGACTTTTACTCTAAT
CATGGGTTGTTTAACATACGATACATAGCATAAACCGAATATTAAGCTTA
AGGTCAAGTGTATTTAAAAAGAAAAAAAAAGGCGGAAATCGAAAGCTCGA
AAGCAAAACCAAACAAACCAAAAAAAAGAAAACGGAAATGAAAGTGAAAT
GAAAAACTCGTACTAGTAAGGGCGTACGCGAAATATAGATGAGATATTGA
TTTTTAGCGCTAGAACATAACATTATTAGTATCATAATCGAATCGAATTG
TACTACCAAACGGCCGTGTTTATGTTGGCTAACATATTGATCTTATATAC
AAACATGCACATTATTGCATCTAACGTATCCATTTAGCTCTTTGTTACCT
CCACGTCATTATGGATATATGTACATGCATGCATACCTAGATTTGTAAGG
TCCAAAGTTTAAAGCATAATTTTTTCTCACTCGGACGGATCGCCTTCCAA
AGGTCGCGCATCACCGAAATATTAATATTTCCACAACGCTCGTGTGTATT
CTATATCCCGATTAACGTATAGTATACACCTCCGATCCAAGGCCTTGTTA
ATGAAAATATGGTTGTAGCTTCTTGAAATCAAACAGCATATCAGTTGGGA
TCATTCTAATCGTAATCAATAATAATCAATACCGAACAAAATCGTACTTC
ATTTATCCCTAATTTTCAGTCCTTGATTTTTTTTTCGTCCTTGTCCATGT
CCTTGTCTCAGATTTTTTGAATACTTAAGTGCATCGATAACTGGAGGAGA
GCTAGAGAGGTTGTTAAATTATTAAATAATTCGAAACATTATATGTGCGT
GAGCTTGATCAGTAGTTGGGTTTTCCTCAGTTTATCCACGATCTAGAAAT
GTAAATGAGAAACACTTAGGAAATGTTTAACGTTAACAAAACTGTGCCAT
TCAAAATGGATACATATCGTTTAATTGTTGTTAATTCGGTTGCGGAACCA
ATGACCATTTGAGGCAAAACCAATTAATTGTATATTTGTATCTTTTTCAA
GTCGAAAACACAACACAACTCGGACCAATGGGTAAATACTTGATTCTTTG
ATTGAAAACGGTCCCTAAAAACCAAAATCAAAATCGAAATTGAAATCGAA
AACCAAAACCGTAATCCCTAAAAGTAATTCAATTAAACGAAATAAATCAC
GATCAAGAACAAGAAGCAAATGAATACTTGCCACTTTCATTTCTCGAATT
GGGCGTAAGGTGCGGACCCTTCATTCGGTATGCACATAGCCAATGCTCAC
TGTACCCTTCCCCCACATGCGAGTATATCAGTTTATGTCTAAGGCTTTAG
CTTTCGCTTCAAACGATCATCGCCTATGTATTTAAAGCCCCGAAAAACTT
TCGATATCCTTACTCACTGACGGCATTCCAAATTCATATTGCTTTTAAGA
TCGGTTATTATATACAAACATACCCACGCTCTCTTTACAAATTGTATTTC
GAAATCAAAGCTCAGCTTGAAAACACACAAAAAAAAAAACGGAAAAAAAC
AGAAGTAAGCAAATTTAAGAAACGAAATTATTGATAAGGCTTGAGGCCTA
AGTACTTGGGTAAACTAATTTCAAATGGTCCAGTGTAGTTATTGTAAATT
ATTCAAATTGATCCCGACCCGAATCGGTCCTTGGAGTATGCCCTTAAATA
ACACAAATGAAAAACAGAACAGAATAAAACAAAACAAAACAAAACAAGAC
AAATGTTGGAGTGAGATAACGAAACAATACTTAGAGACTAATAAAAAGTG
ACGAAACGAAACTTTTAGAAAGATTTTGGTTACAGAATTATATTTAATAA
TTACTACATTTAAAATTGAGATTATAAAACTACATACATACATAATGTAT
AACGCGGGCGTCTGGTCAATATGGCCGATGCGACTGCGACGGCGCCAAAA
GATACCGTCATTGTCAAGCAAAAAACCAAAAGCAACTAAAACTTAATGCA
AAATTGTATAAAAAAAAAACCACACACAAACACACACATTTGTTTTTTCT
ATTAAAACATTCAAAACATCTGAAGTGGCTTTCATTTTCCCACAGAATAA
ACATCTGCATTTGATTTTCACTGCATATGTAGGTATATTTACATATTTAA
CGACTATCCGATATTAAATAGTAAAACAATATCATCTTAAAGTTATCCTT
AATTTACACCGCCTCAGCCCTCGTACTCCACATCGGCATCTGTGTACATC
TTGGCTGGCTGCCCAGCCAGGCCATTATCCGTCTCCATCATTTCCACATC
GCGACAACTGGCCGCCTGGAGCTCCCTTCTCACATCGGGTGTAATCTTGA
AATGGCTCTTCTTTCTGCAATTGTGATTTACAGTTACTAACAGTTCTAGG
GTTTCAATAGCATTCGATTTACTTACTTGAGCAGCTGCAGCAGTGCATCC
CGCTGTTCGGAGGATATATCGTTCTTGTATCGCTGGGCAAAGGTGAGCAG
GCTCTGGTGCCATAGCACTGGTAACTCACGCTTGTCGTTCTCGAATCTGC
AAGAAACCATGTTATTTCGATTTCTAAAAGGCATTGTAGTGAGAATACCA
ACCTTAGAAAATGAAAGACTGCGGCATCCACGACGCGATAAGGCAGAGCA
TACCGCTTGTCCAGAAAGTAACGGATGAATATGGAGTTAGCTCCCGAATA
GGCCATCTCACAGATCTTCAGCAGGCAGGCGGAGGAGTGCAGGACGGGAA
TAGAGCTGCGGGCCACCACACTGCCGAAAATGATGGCCTCGCGCAATGTG
CAATCGCCGCCCTCGAGCAGCGGCAGAATGATTCCCTTCATGAAGGCAGC
CGGCTTGAAGAGAGCCCTCTTCAGTGCATTGTACAGATGCATATTGAGCT
TCTTATATTCGCAGAGATCATCACGAACTCGTGGCAGGAGCACCAGGTTA
TAGAACCTCTGGGCCATTGCCTGCGACAGCACCGAGCAGAAGATGCGGGT
GCCTTGGAACATGGCGGCAGCGCTCCAATTATGGGGCTCAGTGATGAACA
AGATCTGCTCCCAATTGCGCAGCTTGGGTATGATCTTGAAGGCCTTAGGG
ATCTTGCCACTGCGATAGCGTTTCAACACATCGCGCACGCCCTCGTACAT
CTCCTTCACTTTCGGGTCGATTTCCTCGATCTTTAGTGAGCCCTCGTCAG
AGATCTTAGTGTGTATGTCGGCCTCCTTCTCCTGGATCTTCTGCATGATC
ATCTTGGACAGGTGCAACGTACGCTTGCCCTCCTGTGCTGGCTGCTGGAA
GCGCTCGAACGCGGCCACATCGTCTTCGTCCATGTCCAGGTCGGCCATGA
GGTCAGTCTCGTTGACCTCTTCATCCTCCTTGACATGGCCATCATCTAAG
TAAGGACAGGTAATGTTGGTTAGCTTAGCTTAGGATAGTGAAACTTAGGG
CGCACTTACTCAAACTGAAGTTGACTTTCTTGACGGTCACCAGACTGGGA
AAGTTCTCTTCGTCCAGCTCCAACTGCTGCAGCTTGGCCGCGGCCAGGAT
CTTTTGACTACTTCTGGCATCGATGTTCTGTGTTCAAATAGGAAAGAATT
TGTTTAAAAACACAAAACGCAGTTCAAACCCGGATTCTTACCGCCGATTC
CTCGGCCCGCAGTTTGACTTTATCCTTGTTCTTGTTTTTCGCCACCCTGC
CCTCGGTGATCTGCTTCTCCAGATTCACATTTTTAATCGTTGCCACGTTG
GCCTTCTTCGGCTTACCCATTTTGCTCGGATATTGTCAAAAATCAAGTGT
AATAATAAGGGCAACAAAAATTGTAATCACTACACGTGCTGCAACAAAGC
AGTGGCGTTACCGGATATTTTGAAAGAATCGAAAAACAAAACACATTTTC
GCACGTGTGGCAACGTCGCAGGGCTGGCTTTTCGATAGGCTTGTGAGACC
AGGGATGGTGGCGCAAACGATATTGAATGCAGTAATTCAATAAAATCTAT
ATATATTGTTTTTGAAGTTTATTATGAAATCGATTGTACCGATATAATTC
GTTTCAAGATGTATTTAAAAAGTCGCATAAATAAATATTTAGAACGCACA
ATATAGCATGTTTGATGAATCAGTGCAATTATCTCCATTCTCGTGTATTA
TTAATAACGAGTGTTATTTTCGTACTTATTTGGCATAATTCTTATAATTT
TAATTAATACAAACAATTTAGTGATCTTCATAGTTTTAATAAACTCATTT
ACTTTTTAATATTTGTTATGTCTCAGTTTTAATGTTATAGTGAAGGTTGG
ATATATAAATCCACTTCATATTTTGGTACGTTTTTACATCGAAAGAAATT
ATTAAATATCGCCGTGAGCACGAACTATCGATATGCGGCGGTACAGCTGG
TCGATCTGTCATCTCTACTTCCTCCTATCGGTCTTTTTCAACCCTGCGCT
CGCAGCCAACAGACCTCCGCCGTTTCTTTTTTTTTCTGCGTTGCGTGCAA
ACAGACCGACAATATGAAGGTGTGCTAAAAATTTGTGATAATACTGATAT
AAATTATATCAATTTGTGAAATATTGCGAAAATGCTAAAGCGCAAGCATT
GGCGCGGTGATCAAACAAATTGCAAGCGAAAATGTCCAGTGATTGCGTTA
AAATAAGTGGATGATATTATCTCCGCTGCAATTCGACTTAATATACATTT
ATATGTATGTTTATGCATTGTGTGTGACTTTTTTTTTTGCATTGTGTGTT
CCAGCTCAACGTTTCCTATCCCGCGACGGGATGCCAAAAGCTATTCGAAG
TGGTCGACGAGCACAAGCTGCGCGTCTTCTACGAGAAGCGTATGGGACAG
GTTGTGGAGGCCGATATCCTCGGTGACGAGTGGAAGGGCTACCAGCTGCG
CATCGCCGGCGGCAACGACAAGCAGGGATTCCCCATGAAGCAGGGTGTCT
TGACCCACGGTAAGTTTGCAATGCGATTTACAATTATGGTGTTGAGCAGT
GAATGATTGTATCTGGCTAGCCGGCATAGGTTTAGTCTTTTGTACGCCTT
GAAAGAGTGGTTCCTATTAAGAAACGTATGGAAATCCTTTTAAGCATTTG
TAATAAAGCCTAGCAACCTGGATCAGTCTTGTGATAATATATCTAAAAGA
ACATAACCTTAATATGGAAGCGTCTGTGTATACTTCTGTGCATATTCGTG
GCGAGTTTTTCGATTCTTAGTAATACAAAGCGAATATTTCCAACAATTTA
GTTGCAACGTTGCTAGCAGCTAGTAATTTACTATATGTGATTGGAGTACG
TTCCAAAGATGAGCAAACAATTAGTAGGATAAATTTCCTTAAGTATTTGC
AAACACATTTCCTTACACCCGAATGGCTAATGGCTAACCAGATAATAACT
TTCCAATCACTGCTCATATCCATGGACTGCTCTCAAGAAACTACTACAAA
AAGCAATCATCTTTTCCAACAGGCCGTGTGCGTCTGCTCCTGAAGAAGGG
ACACTCCTGCTACCGTCCACGCCGCACTGGCGAGCGTAAGCGCAAGTCTG
TGCGTGGATGCATCGTGGACGCCAACATGTCTGTGCTGGCTCTGGTCGTC
TTGAAGAAGGGTGAGAAGGACATTCCCGGTCTCACCGACACCACCATCCC
ACGTCGCCTGGGACCCAAGCGTGCTAGCAAGATCCGCAAGCTCTACAACT
TGAGCAAGGAAGATGATGTGCGTCGCTTCGTTGTGCGTCGCCCTTTGCCC
GCCAAGGACAACAAGAAGGCCACCTCCAAGGCCCCCAAAATTCAGCGCCT
GATCACCCCCGTTGTGCTGCAGCGCAAGCACCGTCGCATTGCGCTGAAGA
AGAAGCGCCAGATCGCTTCCAAGGAGGCTTCCGCCGACTACGCCAAGCTG
TTGGTGCAGCGCAAGAAGGAGTCCAAGGCCAAGCGCGAGGAGGCCAAGCG
CCGCCGTTCTGCCTCCATTCGCGAGTCCAAGAGCTCTGTCTCCAGCGACA
AGAAGTAAACACCGCGACACGGAACCCACATTCTTCGTTTAAGCAGAAAC
TGAACGTTGATCACAACCAAATGATCCACGAGAGGAGAAATAAAACTTTG
TAACCATTTATGTTAAATAAACGCGATAAATGGTATAGAATGTGGTGTGT
TGTGTTCAATTATATTGATCGATTGAGCGAGTGTAAGCTTTAGGATATAT
ATACTAAAGTATCGGGTGTAAATGTTTTCATATTGCATGTGATTTTGGTT
ATGAGCTAGCCAGCGGCATTTTTTGGTAAGGAAACCATGGAAAACAAACA
CTATCTTGGAATTCCAACATAAGCCATTATATGGCCAAATCGGAATCGGA
AAGAGATGGAAACAGGAAATCGTGAGCGGATATATGTAGCTATCTCTTGC
GATTTGCTGCAGTCCCCGCCAAAACAATAATGGTCCCATGTGTAGATTTC
TATGTTCCGTATGGAAACCCTTTTAAGCATCTGTAATAAGCCAAGCAACC
TGGGTATCTTCTGTCATGAGGTTGCTTGTCTTCTTCTGTCATTAGCCAAG
CAACCTGGATCAGTCTTGTGATAATATATCTAGAGAACATACCTTAAATA
TGAAATCGTCTGTGTATTCTTATGTGCATATTCGTGGTGAGTTCTTCCAT
TCTGAGCAATACAAAGCGAATATTTCCAGTTGCTAAAAGCTAATAATTAA
CTATATGTGATTGGAGTACGCTCCAAAGTTGAGCATCCAATTGGTATAAT
AAATTTCCTTAAGTATTTGCAAACACATCCATCCATGGACTCCTCTCAAG
AAACTACTTAAAAAAACAATCATCTTTTCCAACAGGCCGTTTGCGTCTCC
TGAAGAAGATACACTCGTGCTTCCATCCACGCTGCAATAAAGTGCGCAAG
TGCAAGACTGTGCGTAAATACACCGTGGAAGCCAACGTATCCGCGCTGAC
TTTGGTCGTTCTCAAGAAGAATCCCTCCCCATGTCGCCTGGGACCCGTGC
GTTCCAGCAACATCAGCAAGATCTACTATTTGTGCGAGGAAGATGATGAG
GTTATCCCTGTTAAGCTGCAGCGCAGGCACCAGAAGAAGCGCCAGAATGC
AACCAAGGAGGCTATCGCCGAATACGTCAAACTGTTGGTCAAGCGCAAGA
AGGAGTCCAAGGCCAACCGCGGCCGTTATGTCACCATTCGCAAGCCGAAA
AGCTCTGTCTTCAGCGGCAAGAAGTAAATACCGCAGACTCTGAACCCACA
TTCTTCGTTTAAGCAGAAACTGAATGTTGATCACAATAACCATTTTTGTT
AAATAAACGCGATAAATGGTATAGAATGTGGTGTGTTGTGTTCAATTATA
TTGATCGATTGAGCGAGTGTAAGCTTTAGGATATATATACTAAAGTATCG
GGTGTAAATGTTTTCATATTGCATGTGATTTTGGTTATGAGCTAGCCAGC
GGCATTTTTTGGTAAGGAAACCATGGAAAACAAACAAACAGTATCTTGGA
ATTCCAACATAAGCCATTATATGGGCAAATCGGAATCGGAAAGAGATGGA
AACAGGAAATCGTGAGCGGATATATGTAGCTATCTATTGCGATTTGCTGC
AGTCCCCGCTAAAGCAATAATGGTCCCATGTGTAGATTTCTATGTTCCGT
ATGGAAACCCTTTTAAGCATCTGTAATAAGCTAAGCAACCTGGGTATCTT
CTGTCATGAGGTTGCTTGTCTTCTTCTGTCATTAGCCAAGCAACCTGGAT
CAGTCTTGTGATAATATATCTAGAGAACATACCTTAAATATGAAATCGTC
TGTGTATTCTTATGTGCATATTCGTGGTGAGTTCTTCCATTCTGAGCAAT
ACAAAGCGAATATTTCCAGTTGCTAAAAGCTAATAATTAACTATATGTGA
TTGGAGTACGCTCCAAAGTTGAGCATCCAATTGGTATAATAAATTTCCTT
AAGTATTTGCAAACACATCCATCCATGGACTCCTCTCAAGAAACTACTTA
AAAAAACAATCATCTTTTCCAACAGGCCGTTTGCGTCTCCTGAAGAAGAT
ACACTCGTGCTTCCATCCACGCTGCAATAAAGTGCGCAAGTGCAAGACTG
TGCGTAAATACACCGTGGAAGCCAACGTATCCGCGCTGACTTTGGTCGTT
CTCAAGAAGAATCCCTCCCCATGTCGCCTGGGACCCGTGCGTTCCAGCAA
CATCAGCAAGATCTACTATTTGTGCGAGGAAGATGATGAGGTCATCCCTG
TTAAGCTGCAGCGCAGGCACCAGAAGAAGCGCCAGAATGCAACCAAGGAG
GCTATCGCCGAATACGTCAAACTGTTGGTCAAGCGCAAGAAGGAGTCCAA
GGCCAACCGCGGCCGTTATGTCACCATTCGCAAGCCGAAAAGCTCTGTCT
TCAGCGGCAAGAAGTAAATACCGCAGACTCTGAACCCACATTCTTCGTTT
AAGCAGAAACTGAATGTTGATCACAATAACCATTTTTGTTAAATAAACGC
GATAAATGGTATAGAATGTGGTGTGTTGTGTTCAATTATGTATATTGAGC
GATTGAGCTAATTAAGCTTTAGGATATCTATTCTAATGTATCGGGTGCCA
GCGGAAACGCTGAAAAATATTTTTGATTTTTAATTAATTATTTCAATCTA
TTTTTCCCCCAGGTAAATGCAACAGTTCCGACAAATAGTTCAATTAAAGT
AAGGCCATTTATTATTTTCTGAGAAAGGAAGGTCGAAAAACTGTTTAAAT
GGTTTTTTTTTTACAACATTACGATTTACCCAATCATAGGTATATTAATA
TTGTTAAACAAATAAACGCAGAACAAACACTATCTTCGAATTCCAACATA
AGCCATTATATGGGCAAATCGGAATCGGAAAGAGATGGAAACAGGAAATC
GTGAGCCGATATATGTAGCTATCTCTTGCGATTTGCTGCAGTTCCCGCCA
AAACAATAATGGATTCGTTTAAATTCTGATCTAGACATATATTCTATACG
TAAGTTAAATAAATGTAAAACAAGTAGAATGTGTGTATATAAGATATTTT
AACGTTTTTAGGGCAGTCGAGCAATTTCCAGTTGTAACATGTACGTGGCT
AGCAACTCATCCGCGTTACGATTTCTACCTGCTGGCGGTGCCACTTGGGA
TGGGGCTTCCTCCGCCAGCTGCCGGCACGCTTGGAGCTACATTGGAAGTC
GGAAGGGTATTAGTCGAGCCCGCTTCTTCGTATCGCGTTAGCTTTGCCTC
CTGATCGGCCAGCAGTTCGAGCAAATCTTCTTGATCCTTTTGCATCGCCG
CCAGGGAATCTTGCGCCGCATCTGCACTCTGTTTTTCGGCTGATAACTGC
TGACGTAGTGTCTCCAGCTCCTTAGTTAGACGAATGTTTTCGGCAAAGTA
CATGTTGGCCTGGTAGCGAGCGGCATTTAGCTCCTCCTCGTTGGGCGGCG
TGGCTTCCGCACCTTGGGCGGACTGCACCTGACCGGTCGAGGCTCCCAGC
TGTGCCTTAAGCAGCGTGTTCTGGTCCAAGAGCTGCGCCTTGAGCGACTG
CTCCTCACCAAGTTTCTCCTTCAGCTCGGCATTCTCCTGTTCCAGTTCTT
TGGAGGATTGCTGCAGTGCTTGGATCTGGGCATCCATGCCGCGGATAATC
CCCTTGTACTGGGAAACCAATGCAGAAGCTTCCGAGCTCAACGTGAGTTC
GGTCAGTTCAATGCCATCTACATCAAATCCGCTAACCAGCTTGGCAATCA
ACGCCTCCAGTCCCTTGTACAGCTTGCAATACTCGAAGTCAAGCAGTAGT
TCCCCAGCGGATTTGGCACGGATCTGGGCCTGCTTGCATGCCCGACTGTA
GGCCTCATGTCGCGACACTTCTGCTAGTTTGCTACAGAAGCTCTCCTGGC
CAATTCGCTTGATGATCAGCTGACTGATGTCCTCGCGCTTCTGCCCCGGC
AGCGAGTTGTCATTGAACTGGATGCACAGGCCCATTAGGAATGCGCACAT
GCCCTGGACAAGGAACTCTCGTTCATCGTGCTCGTTGGAGCAAAGTTGAG
CGGTCAGGTAGGCCATGGTGCCCTGCGTTTCCAGCAAAGCCTTCACCGCA
CCTGGACAATGCGCCAGCCACAGGCTGAGTAGCATTAGCAGACCCACCTT
GCTTTGCAAACGGTAGCGTTCCTGCTGCATGAGATTAGTGCACTGCTCGA
GTAGCGTGATAGGCTTTTGGCCACCAGGAGTGGCCAGCAGTACGCGCAGT
AGTTCCTCCTTTAGGGCGACATTCTCTACGAGTGAGTGCATTAGGGCCAC
AGCGGAGAACCAGTTGGCAAGCGCATCTGTGGAGAAGAGTCCGGTGCAAA
GGAGTTGTCCCGTCGAAAGGGCACTCACATCGGACGCACTGGAGGGCAGC
AGGGTCTGTACAACCGCCCGCTGGCCATCGGCATTGCGATAAAGAAAGCA
CTCGAAACAGTAGAGTACGGCGCAACGCAGTGCCAGCAGTTGTTTCTCAT
TGATCATGGACATAAGAAGGACCACGATGGCAGGTCTGGGTGGACTGCTC
GGAGCCATAACTCTTCCCAATTCATCCTGGTTGTCCCGATCGCCGCGCAC
CACTTCGGCCACTGCATTGATGGTTTCCGTGAGTATATCCGCAGGGACAC
CACTGCTCATCAGAATCTCGCAAAGAGCATGGAGCAGTCGAGACTTTTGC
ATGACCCGCTGGCAGGCGGCCACCACCTGCTGTTGATTACTGGGCGTGAC
CAGTGCCCGCACCACCTGCAGCAGACAATGGAAGTTTGAGACCTTCTGTG
GCGACCAGCCAACCTCTTCCGCATCCTGTGAGAGCTCAAACATTGGCGAC
AATCGCTGGATATAGCTGCCCTCCTTAAAGAACTGCTGATTACTGGAGTT
GTTCTTGAGAAGATTCAATAGCAGAATTAGGCAATCCTCCACAACAATTC
CGCCATCCGAACAGCCCTCCTCACGGACAATTTCAAAAAGGCGGTCAAAG
GCATTCTCAAAGGCCACAATCTTTTGGATGTTTGAGTTGCCCTTGGTCAG
TTCGATAAGCAGCAGAAGGACATCGTTGCGAATCACTTCGCGGCTGTCCG
TCAGCAGATCCATCAGCTTGGAAACGCCCATCGGACTGACCAGAATCAAA
TCCTGCAGCTCCCGCGTCTTGTTCGAAATGAGGGACGTAATCAGTTGGAT
GGCAGCGCGACGCACTCGAAAATCGTATTCGTCCAGATAGCCCATTACCA
GGGTTACATGCTCCGGTGTCTTGATGAACATCTCCGTGAACTGCTCGCCC
ACATTCACCGAAACGGTGGGATTATCAGCCTCCTCGTCGAACTCCTCGCT
AGTAACCACGTTGCACAGTGTGTCCAGCGCATAGCTGATGATCTCTGCAT
CCTGTCCGTCGTTCTGGAGCACCTGGACCAGCGGAGGCATGCCCTGTGCG
CCCACCTCGATGCGGTACTTGCGGGACAGGGCTTTTAGCGCTCGGCAGGC
ATCCCGTCGATCCTCCAGGAGCGTTGAGGAGTAGACACGGTCCACCAGCT
TCTCCACCGTCTCGGCGGCACTCGGCTGCTGACCCGGCTCCGTGCTGCCC
AGCACCGTTTTGATGCCACTCTTCAGGAACTCCATGCGAGTGTGTGTTTA
CGGTCTATTCTGGGTTTTTTCGCATTCAACAAGACACGTCAATTCATGAA
AACAATTGACGGGCGGCTTAGCGATGGCTAAAGTCCGATAGACGCCCACT
TATCGATAAGCGGCTTGTCTTTAAATATATTAAATATATTTTTAGAATTA
CAATTTACCATATTTGACCATGTTTGTGTAATTACCTATATTTACACTTT
TTTGATAATCTAAAACTTTTTTTTGAATTACATAAAATATTGCTACTTTC
TAGCTGACGTCGGGACTTAAGCTGAGTGGCATCCCTGTCGGCGATAGTCT
TACTGCCAAAATTTTATTAAACTAAAAACGACTCGACAGCCCTGGTGCTA
TCGATGCTATAAGTAAGTTGAAAACAAAACTAATTTAGCAAATTTGTGTT
TAAAACTAAACGAGAGAATCCCAAAAAATACAATATAAAGCGTTCCACAC
ACGCGGCGTAAGAAGTTCTCAAAAATATCAACACAGTTATCACGACGCTG
GGAGAAATCACTCGTTTTTATTACGTAATGCGGCAAAATGTCAACCCATA
ACATAACAATCCCCACATCAATTTGTGTAAATCATATGTAAATCTCGCCA
TCTCCTGTGCTTGTCTTGCAGACCTATGGGCAGTGGGATTGTGGTTCAAT
TGGCTCGAAAGTACGGCGCAGTGATATTCTTTCCCACTGTTGCAGTCGGA
TCGATTTACGCAGATTGGTCGCACACCCGCCAGTGGAAACGCCAGCAGCT
CCAGTTGGCACACCGAGCCCAGCTGAAGGATCAGCGCTAAGAGGATACAC
AAATATACACCATGGTCTTGGGACTGGATAAGCGAGCACTGTGGGGCGCG
TTGCCCCTGCTGGGATTTGCCATTGGCCACTTCCTGGACAAGAAGGAAAC
GGAACGTATGACCATGTTCCGGGACAAGAGTGCCCTATACGGCCGTCCCG
CCGGCAGCGAGGGTAAGGCGCCATCCTGGTAGGCCTGCCCAACATCGCCA
TCCCAAAATATTATTTTTTTTCCCCCAATTCACTGTTATTCAATAAACCG
GAGAAATGTGAAATACGCCTGTCGTCTAGTTTACCTGCATGGCCAGCGGA
CGAGATTTGCGGTCGGGAACGTGATTTATTTGTGAAGGATTGCGTACCAT
TGTTTGTTTTACTCAGGAAAAACATAAAAACCTCAACACACGTCTAACGA
TAAGCCGAAAACCAATGAAAAATCCAAGGAGATAACTCGTTTTTCGAAGG
ATTTTACCTGGGCATCGCTGCACGATATGCGAGTTCTGCTTAGTTCGGAT
CAGGGGCGTAGGCTGGATATTTTAGAAGAGCATTGGTGTATTCTACCAAA
ACTCTTATTATTTATTGTAGAACTTCTTGAGCATGTCACATAAATCACTT
GAAATGTGGTAACCGAGAGTAGTCTTTTTAAATGAGTTTCGTTAAATGGC
ATTGAATTATCTAATACATGTGAATCGAGATTTTTAAGAATTAATAGAAA
AAAAAAACTTTTATAAGCATGAGCCCCCTAAAAACTTTCATTTGCACGAC
CATGCCTATATGTACTATGTAACTGCTTCCAGTAAAAACCGTTAGACAGA
ATGGATAATCGCTCACTTCAAATATGAAATATGAAATCCGATAAGGACAT
TTCCACTTTAACAAACAAGGCAGCAAATTGAAATGCCAATGGAACAAAAC
TAATTTATTTTTATGGCTCAGGGCTAGGGGTTTGTACTCGGTTTTGGATT
CCGGTTTAAGATCGGTTTTGGGCTCGAGTTCCAAAATTGAGCGTGATGAA
TCGCTGGAATTGTGTTCTTGGGCGTGCTGCCCCTCTCTAGACCATTGTTT
CCAATGGTCAGTAGTTTGTACACAGGCGCAGTGGGATCAAATGGAACGGA
TTTTCCAGATTTTCGCCTTTCAAGGGCTTTCTCTCTCTCACAGCGGGGGA
GAGCGTGAGCGAGAGGGTGAGATGCCAGAGATTTGCAAGTGGATACCGTT
GAACTGTGGTTGGGAGCGAGAGGGTAATAGCACGATCTTTGTTCCTGGAA
GGAAACGAGAGATCCAGACGTGCAACAATAACATAACAGTGCTGGTGTCT
CTCGGCGGGAAAATAGCCAAATTGGGCATTAGCATGCAGGTGCGAAAGGG
TTTTATGGAGAGGTTATTTATATGAAGGTCAGGTTGAAATGACTGCTATC
AATTTTAATCGGTAGTTGTCTTGTATATTGGTTTTTAAATAGTTTTGTAT
TTTAATCCATATTACAATTTCTTAATTTAATGATGAAATAGCTATTTGTT
TATGTATGTAATTATATCATTAGATTGCATATTTGCAAAATGTATTTTGT
AAAAATTACAAATCTAGCTTGTTTTTAGAATATTCATTCTTCCGCCCTAT
TTAGCGGGGTAGCGGCACTACTTAAACCTCTCTCTCGCGCACTTGTTGTT
GCTCTCTCTCCCGTTCTTGCAGGTAGCAATGAGAATTCCAGAAATCCTGC
ATCCCAAAAACCAGTCTCAAATCGTGTTTGGGTTTTGTAGCAAGCGGATC
ATTTGTAATCGGCGGCGGAATACCCAAAATACCCAAAGAGTAAAAAAAAG
ACTTAAGGCAAAATGAGCGGAGAGGAATCTGCCGGCATGGACTTTTCGCA
AAAGACCCTGCAGGATTACGAGGTTTTGGCCGTGATGGGGAATGGATCCT
TCGGCACCTGCTACAAGGTGCGCGACAAAAGCACCGGTGAATTGTTCGCC
TGGAAGGGAATGAACTACGATGAACTGGACGAGGCCAAGTGCGACGCTTT
GGTTTCGGAAATCAGTGTTCTGCGGCAGCTCCAGCATCCTAACATTGTGC
AATACTACCATCATCTGGTGAACCGAGAGGCCAAGTCGGTGTACATTGTT
ATGGAGTGCTGTGCCGGCGGCGATCTCGCCCAGATTGTCCAGCGAGCGAG
ATCCCAGAGGCAGCGGTTTGAGGAGCCCTACATCTGGCGGGTGCTCTTCC
AACTTTGCCGGGCGCTTCAGGTGTGCCACAACAAAATCCCCAACGGAACC
ATCTTGCATCGCGATATCAAGCCAGCAAATATTTTCCTGGATGCGGCCGG
GAATGCCAAACTGGGAGATTTCGGTCTGGCCAGAATGCTGCGACGAGATC
AGAGCTTTGCCGCCTCCTTTGTGGGCACTCCGCACTACATGAGTCCGGAG
TTGGTGAAGGGCAGGAAATACGATCGGAAGAGCGATGTCTGGGCCGTTGG
TTGTTTGGTATACGAGATGTGTGCCCTAAGACCGCCGTTTCGCGGCAGAG
CCTTTGACCAGTTGTCCGAGAAGATCGCCCAGGGTGAGTTCAGTCGGATT
CCGGCAATCTATAGTACTGATCTGCAGGAGATCATCGCCTTCATGCTGGC
AGTGGATCATGAACAGCGTCCTGGCATCGAGGTTATCATTCGGCATCCTC
TGGTGGTGCGTAATATTAGCGAGTTGGATGGCAAGTTCCCAATTCTAGTT
GATTCTGGAGAGGATTTCTACACACTGCCTTCGGGTGCCAGGCTTTTCGA
GGACGAAGAGGAAGATGGAGTTCATCCAGAGCTATCGAGCACCATGTTTA
CGGAACAGTACAGCTTCAATGAAGGCTATGGGCAAAGGAGACTCAGCGTT
ACTGGTGTGTTTACTCCAGATTTGCGAAGTGAACTCTTCTACTCCGCCAA
GCGCAAAATCTTTCCTGCCAAGAAACTACAGCTGTCGGATCCCTCTCTTT
ATGAAAGTATAAGGAGAGAGGAGCGAGCGGAGGAGAGGCAGGTGGAACTG
GCGGAAGAGCGGCGCCGTAAAAAGGATCAGGAGCAGCAGAAAAGGGATCA
GGAGCTTCTAAAGGAGGCCCCTAGCAGTCCTCGTGCTCTTACCCAAAACA
TATTCGATGAAGTACTAAAGACCCGTCTCCACGCCATTCGTGCCCAAGAA
TCCCTGTTGCAGCAGAAGCTCGAAGAGCTGCAGACCCGGGAGCAGGAGTT
ACAGCTGGCCGAACAGCGCGTGCAAACGCTGGAGCGGCAGATGCAGGAAA
AACTTCTTCAGCAGGAGAAACACACTTGTAGTTGCAGACAGCCGATAGCT
CCGCCCATTCCTCCTAGGAAGCCAGCGAAATCGCACCATGATGACACCTA
CTGCACTATCGAACTCAACGAGACGTCGCCCACGGTGGCTAAACTCAATT
TAGCCACACTTCCGGCACCAAAATCGCTAAATACTCTGCGTAAGGTTACC
TTCAAGTCGCCCCAAAAGTTTGTTACCTATGGTATCGAGAATATGCCCCC
ACCGGCGGTTAAACCGGCAGTGAATCCTCCGCCCACTGGCGTTCCCATGC
AAATGAGCGTATCCAGCAATGATTCCGGTGACAGCCAGGCCTCCTCCACC
CGCAGGAAATCTATACTCTCGCTTTTCGGGTTGAGTCGCGGATCCAAGGC
GACATCCAAATCCTTGCCATCGGTCAACCAGGTAGCCCAAGCAGCTGCAA
CTCGCGTGCAGCGACCTCCTTTGGCCGTCAAGCCACCGATCACGCAGGAA
CAGCCGGCAGAAGTTCCACCAGTGGCCAATCTCTGGACAAAGGAGCAGAA
GAAACAAGCCTTCGAGCTGCTGGCGGCCATGAATGCAGCCGAGAGGGAGG
CAAGCGGAGGTGGAGTCGTTGGTTCTGGACCCGGAGGAGCACGTCGCCAG
CATCTGCGGCAATCGGTGAGGGAACGGAATTCCACGCTGCAGCGGAACCG
CATGCGGAGGTCTTTGGTGGTGGCCACTGGCCATCAGAAGCTAACAACGC
GCGACCAGATGGTGATCTGATCAAATTGATCAGGAAAGATGTGCAGTCCA
GGAGCCATGGCAACCATGGAGACTATGAGCGTTGTGATGTGGAATAAGTT
CCGAAATATTTACATTTTTTTTATGCAAAAATTTTTTTGAATGCCATATT
TTAAACACGTATTATTAGCATTAAGATTCCAGTTTTTTCAGCTGCCATTC
ATTGTGCAATTTGCATTAGTCTTAAAATAAATATTGATGAAATGAGATAC
ATTTGTGTTTAAAATTTCAATTTTCGTGTTTTTATTTATTGTTGTTCGCT
TGTAACCGTTAAGTTCAATTTACGCATTTTCAGTGCTGGGTATTGTAAAA
AGAATATATAAACTTAGCATTGCATCTTTACAGCGTAGTTTTCAAGCAAT
ATACTTAAAACAGCAAAAATTAAAAATTACATTTAAAGAATGCTAACTAA
TAGAAAATTACCAGTCGCTTTAATCTTATTTAACAGTTGCCAACACTTTT
ACCGCGCCAGCTGTTGCCTATCGATAGACCGATTACCGGTTTGTTACGCA
AGCAACAGGTCTGGCGTGATTTCTGATTGGATTCTTGCCATTTACCTGTG
TGATTGCTGTGCTAGTTAATACAAATTAATTAAATTCCAAGATGTCCGCC
CGACTGCTGCAGGCCACGCGTCGCTGGAGCGCCCATCGCAACTACAGCTC
CAAAATCGCCGAAGTTGTGGTGGTTTCGGCAGCCCGCACACCAATTGGCA
GCTTCCAAAGTCAATTGGCCCCACTGACGGCTACCCAATTGGGAGCCCGT
GCCATCGAGGCGGCCATCGAAAAGGCCGGAATTGCGAAGACCGATGTCCA
GGAGGTGATTATGGGCAATGTGGTATCTGCTGGTCTGGGACAGGCCCCCG
CCCGTCAGGCTGCCATCTTCGCCGGACTGCCCACCAATGTATGCTGCACC
ACGGTGAACAAGGTGTGCTCGTCGGGCATGAAGGCCGTTATGCTGGGCGC
CCAATCCCTGATGCTCGGCTATGCTGATGTGGTCGTTGCCGGCGGTATGG
AGTCCATGTCGAATGTTCCCTACTATCTGAAGAGGGGAGCCACGCCCTAT
GGCGGCGTCAATCTCACCGACGGCATTGTTTTCGATGGCCTCTGGGATGT
GTACAACAAGTTCCACATGGGCAACTGTGCCGAAAATACGGCCAAAAAAC
TGGAGATCACACGTCAGCAGCAGGATGACTTTGCCATTGAATCATACAAG
AGATCGGCTGCCGCGTGGGCCAACAAGGTGTTCCAGGACGAGATTGCCCC
GGTGAAGATTCAGCAGAAGAGGAAGCCGGAGATCGTCATCTCAGAGGATG
AGGAGTACAAGCGGGTGAATTTTGACAAGTTTGGACAGTTGGCCACCGTT
TTCCAAAGGGAAAATGGCACTGTGACAGCCGGAAATGCATCCACCTTGAA
TGATGGCGGTGCCGCCGTGGTTTTGATGAGTGCCGAGGCAGCCCAGAAGG
CGGGCATTAAGCCGCTGGCCAGGATTGTGGCCTTCCAGGATGCGGAGACC
GATCCCATTGACTTCCCCATTGCCCCAGCTCTGGCCATTCCCAAATTACT
GAAGCGTGCCGGCGTTCGCAAGGAAGACGTGGCCATGTGGGAGGTCAATG
AGGCCTTCTCCCTGGTCGTTTTGGCCAATATCAAGAAACTGGATGTGGAT
CCAGCCAAGGTTAATGTTCATGGAGGTGCCGTGTCAATTGGCCATCCAAT
CGGCATGTCCGGAGCCCGTCTGGTGGCCCATCTTTCGCACAGCCTGAAGA
AGGGCGAGCTGGGATGCGCCTCCATTTGCAATGGCGGCGGTGGAGCCTCC
TCCATTCTCATCGAGAAGCTGTAAAGGTCACCTGGCGGACCTGCTCTCAA
CCAGAAATGCATTTACTACTGATCCATCGAGATTATTGTGGAAAGCTCTA
TGTTTTTTTTTAAATTGTTAAGTGTCTTGATTGCGCGTGGCCGCATTTAA
CGAACTATTGTGATTTGCATAATAAAATTATGAAACAGTCAATAATTATT
ATATGTATATCAAATCAGTGTTCTTCCATGACGGTAATAGGGTTCAAAGT
CTAAACATCTTATATTTGTTCTGTGAAAAAAATGAATTAAGTGCTGAAAA
TGTTCTTTATTGTTGAATTTATATATATATATATATATGCCTATAAATTC
ACCATTTAATATATACCTAAAAAAATGATAATTTCGGCATTTAAGGATAT
TATACCCGTTACTCGTAAAGTAAAAGCATTAGCATTCTCTCTTGTTTTCA
TAATTTATTTAGTAATAATAAGTAAAATATTTTGTTCAGAGCCCTGCTCG
TCTGGAGGCCAGAAGTTCGCATATGAAGACGACCAGCGACAGGAGATATA
GTCCTGCGGTCAGGATGTAGACCGCCCACAGATCCGGCTGTCGGATGCGC
TTCTCCCGGTACAGGAACCGACTGCGGAAGTACCGCTCGCTAGCCATTTG
GCCCGCCCAGTGGTGCACCAGGCCAACGGATCGAATGGACATGACGAGGT
GGTCCAAGTGGCTGGCCAGATGCGAGTGCTTCTGCAGATAAATGGCCAGC
TGCTGCTCCAGAACGTCTTGCGGTATGATGTGATACGCTCCAGCCCGATG
GCCCCGTTGGGTGAGATGGAGAAGTGCATCCTGGGAAATCAGGCCAAAGA
AAAGTGGATGTGAGCCGGCTCCTTCTCGCAGCGTACACCGATCTAACGTG
CGAAGCACCTCCTCCTCCCGTTCAGAGGTCACTATCACGGATTTGAGACC
CAGCAGATCCTGCAGACTGGGCACCTCCCTCAGATCTTGCAACGTGGTCC
GACCCATTACGGCCGCATAGTCGCCATGGGTTAGATCCTGCAGATTTCCT
GGCAATCGCTGGTGCAGATGGTATCGCAGGATGAAGAACAACAGCGCCGA
GTACATGGATCTAACGATCAGGCCAAAAATCAGCCAACTGGCGAAGAGCA
ACTGCAGCGACGGCCGCTCAGGGGGATCGATGGGCAAGCCAAGTGAGGCG
GCATAGACCGCCAGAACGAGAGCCAACCGATCCCCCGCGCCGCGTCAATG
GAGCAATGCTAGGCAGGATATACTCAAAAAACTAAACACCAGGCAGATCC
AAGTGAGTGCCTGAAACGGAAACGACCAAATCTCCAGGCTGGTCAGGTTG
TGGGCATTCAACAGGAGACATCCCACCACCCGGTTCGAGTAATGCGGAAA
CACGGGCGTCAGATTCGTTGCGTACTGGATGCGCTTCCTCACATAACCAA
TCGCCAGGTGGGCTATACGCTCCTGGACCTGTTCAAATATTATTAAAATT
ATCGTTCAATGAAATTCTCAAATGATCGATCCTACCAGCTTCTGTAGCAA
CTGTTTCTCCGTCCATGTTGTGCGATTCTTCAGTTGATCCTGTAAGCCCG
AAAACTGTATGCTAAAGTTCATCCTGCGCGACAATTCCTGCAGCAGACGC
CCCTCCAAGCCGCGAAGCTCTCGCTGCCCCTCATCTAGGTCTAAAAAGGG
CGACACTTTCCTAGCCAAAACAATCAAAGGGCACCCGTTGAGGTTATGCA
ACTTGGAGGGAAAGTAGTCGCGATGCTTCCACGATTCGCCCAAAAACATA
TTGATCCTGGTCGGCTGGGAATCGTTGCATTGGCCAGGCGCGTAAGGGAA
GTACGTGTGGAGCAGCACCTGGCCACCGGAACTCTGCGTCATCACATTGC
AGTTGATCAACTGGTGGCGCCAGCAGTACGCGAACACACCCTGCATATCG
TGCGGAATCAGTGCATCCCGCTGCTGCAGGAAGATAAAGTAGTACTCGCT
GGTGTCCGACTGCGCCGTATACGTGTGGATCTCGATGTCGCTGGAATATG
CATATAATTTTAGGTTACCGAATTTTTTGCGTAAAAGTGTTTTTTTTTGT
GAAAAAAATATCAGTTTTTTGGCCAAAACAAAAACAATATTGGTCCAAAC
GTGGAATGTTATAGCTCGTTGAATTTGTTACGAAATTCCCAATCGAATAG
TGTCCAAAATTGGGAAAAAAATTTTTTACCCATTTTTTGCAAATTTTAAG
CCCCTAAAAAACAGCAAAAAATTGCCAAAAAAAATAAAATTATATGAATT
ATCCTAAATTTATACAGATTGTTAGCTGATCTTTTCAGACTCACAAAACA
GTCACTAATTTCGTTTATGTGGCTTATTTTGACCAAGTTACGACTGAAAA
TCTATCGAAATCTGCAGGATATTACATTTAAGTGGTTAGCCCTCGAAAGA
AGTTGCTAATCACTTTAATATCTTACAGCAGTGCATCCAGCGAATCCACC
AGCAGTAGATTGTGAGTCCTGGGACCGGCGATCCGACGCGGACGACCGAG
CTCGACCAGGACTAGCTGAACGATCATCGTGTCCACGCTCTCGTAGAGCA
GCTGCATAATGTTGCGGTAGAAGTTCATGGGACTGGGTCGCCGGCAGGAG
AGGACCACAATAAAGGCGGGAGCGATCCGCTGATAGAAGTCCTCGATGAA
GACACGAAGGGCCTGGGCCACGTGATGATTTATTGACGCCGCTTGCGTCT
GGGCGCCGATGTACTTCATCGACTCGAAATTCAGCAGGCTGGTCACGTTC
ATGTCCGTCTATCGAAATCCGGGAAGAATACTGCCGAAATTGACAAGTAC
ACGCGGCGAATTCCATTTCTATCCGGTCTCTATTTGCATCTCATTAGTTG
CCAAGTCAAATAAGACTATTGTGGGACACGCACCAAGTTGGACAATTAGG
CGGGGATTTTGTCCATCAGCTGGTCAATCGTAAATATCTAAATTTATATG
GCCTATAAAAGGTGGTGGTTATGACTCGACCCTAACTGATGTCCATAATC
GTATATGCTTATGGGTCGGCAGGTATGCTCCGTTTACAAGGTGGTGGGCA
TTGCTTCATTGATTGATGTAATCTGTTAACTCGAAATTCTTTCTTTAGCT
AACGCTCTAATTATATAACGTACACTGAACTTTTATATTTTCACAAGACA
TTAAATTTGATATAAAAATTAATTCAATTATACGCGATGTACGAATAAAC
GAATGATTGTTTTGATTGCATTTGATTGTTTTAATATCCTTCGCCAGATT
TAATTTTCCATTTATTTGCCTTTAATTAGTACAATCTCGATAAAGATCAG
ACCATGAATGAACGTGAATCCAAATAACCCAGTCCAGGTTTCAATTGAAA
TCATGTCCTTGCAGTCGAGCATAAAAGTTGGCGCCATGAATACCACCTCC
GATTCCAATGCGGGTTCAAGCTTAAGTTCCGGTTCCGGTTATTCGATCTA
TAAAAGCTACCTGGAGAATTCGAGGATCGATATGCAGGGGGAGGACGCCA
ATCTGTATGTGGCCCGGGCACTACGTCTGGTCATCGAGAATGTGCTGGCC
CAGCTGAGCACCACCCTGGTGGTGACCATTTCCACGCGTCACCTGGGCAC
CGCCCATTGGTTTGAGTATATGATGAACATCCTAATGGATTCGTGGCGAA
TGGTGGCGGTGCAGCTGCTACGCATTCGTCCGGATCTGGTGGTCAATCCG
GTGCCGGGCAGGAAACGCGTCAGCCTGTTGATGGTGGACTCCTATCAGGG
TTTGCTGTAAGTTAACTAAGTCAACTATAATCTTCGCCAGTCTTAATCTT
TCTCTTTAGGGACACCAACATCACGGCCAGCAATGCGAATTTCGATGATC
CGGACTACTACTTCATCTTCTTGCAAGCGCGAGACCATCTTATTCCCAAG
GAGCTTCAATTGATCCTGGATCACTGCTTGGCTCACTTTTGGCTGCACTG
CAACGTGATGATCCAGACCGCCCAGGTGGAGGTGTTGGTCTATACCTATT
ATCCCTACACAGCGGACGCCTGCCAGAAGGCTTATCCCATTCCAGTGAAT
ACTTTTGATGGTCGCAAATGGAAAGCGTCCCAGATGTTTCCCGACAAACT
CAGCCAGATGCACGGCTGTCCACTGACTGTGCTCACCTGGCATCAGCCGC
CCTTCGTAGAGTTGGTCTGGGATCCGAAGCACAATCGCAGCCGTGGCAGT
GGCTTCGAGATCCAGCTGGTGGAGCACCTGGCTCGTCGGATGAACTTCAG
CCTGGAGTTGGTTAATATTGCGCTGCTGCGTCCAAACGCTTATCGCCTGG
CGGAGGGCTCCAGCGAGGGACCCATAGAAAAGGTGAGCAATTATTATTGC
TGAGTTTTGGATTTTCAAATCGATTTCATTCCAGCTCCTGCAACGAAATG
TCAACATCAGCATGGGTTACTTTCGCAAAACGGCGCGCCGGAATCAACTG
CTCACCACCCCCATGTCGTACTACTCGGCCAATCTGGTGGCCGTTCTCCA
GTTGGAGCGCTATCGTATAGGTTCGCTTGCACTGTTGGTATTTCCCTTTG
AGCTCTCCGTTTGGATGCTTCTGCTCCTGGCATTGCTGATTCACCTGGGC
ATCCATCTGCCATCTGCAAGGAGGGGGAATGAAGAAGATGGTGGCGGGGG
ATTGCAGGTGGTGGCCCTGCTTTTGGGCGCCGCCTTGGCTCGACTGCCGC
GCTCCTGGAGGCATCGCTTCATTGCCGCCCACTGGCTGTGGGCCAGTATA
CCCCTGAGGATATCCTATCAGTCCCTGCTCTTTCACTTGATCCGCCTGCA
ACTGTACAATACTCCATCGTTTTCCCTGGATCAACTGCTGGCGGAGGGAT
TCCAGGGTATTTGCACTGCGAATACCCAGCGATTGCTGCTTGAGATGCCA
CAGTTGGCTCGCGATCCGGATAGTATACAATCCGTGGACACACCTTTCGA
TTGGGATGTTTTAAATGTATTGACACGGAATAGGAATCGAAAAATATTCG
CCGTTGCCAATCAGGATGTCACCCTATCCTTTCTACACTCCTCCGCACAT
CCCAATGCGTTTCACGTGGTCAAGCAGCCCGTGAATGTGGAATACGCTGG
AATGTATATGCCCAAACACTCGTTTCTATACGAGAAGATGGACGATGATA
TTCGGCGGCTGGATGCCAGCGGATTTATTCACGCCTGGCGACGCGCATCC
TTTGCATCCGTCCATCGAAAGGAGCAGGTGCACATGACCAGCCGGCGGTA
CATTAACCATGCCAAGCTATCCGGGATCTACATGGTCATGGCGGGTCTGT
ATCTTCTAGCTGGTCTCCTGTTCGCAGGAGAGGTATTACTTCGGCAGAGG
AACTAGAAGCTCTGTATCTGTAATGTATTTATTGAAATAAGATATTTAGT
TAGTATTTAATTTGTGTTAGCATATGTATACATAACAAACAGATTAGCGG
ATTAATTAAGATATTTAATATTTTAAAATGTACGGGTATTTTAATGAAAT
CTTTCTTCTGAAAAAAGAAGCATTTTGCATTGCATTCTTTTCACATGATT
AGTTTTTTTTTTTTGTCAGTGGTTTTGACCCAATTTTTGTGTGTAAGTGA
AACAACCATTAATCATGAAACTTTTCCGGGCAATTAGCTTGAAAGTTACA
CAAAACTTCTAATATGATTCGGAGGCAATATTCTGGTCAGGATATGGATA
TCCTTCATTGAGCCACCTCATGTCCCGGCGGGATGAACATCAGCGCACTG
CTCAACTCGTACTACGATTTGTCCGGGGAGCAAATGAACCACATCAACGA
GTTCGTGGCCCGGGCAGTGCTTCACGTAGTGCACCACTACATCCTGAGTG
TGACCCCATCGTTGGTTTTGACCCTGTGTTGCCGGAGCAATCACACGTGC
AATTTCTACAACAAGATGATGAGCACTTTGTTCCGGGAATGGGGCTTGGC
CCCCCTGCAAATCGTCAATGTGCTGCGTGGTGTTCCATGGCATCCGGTTC
CGGGTCGTCGTCACTTCAATGTCATTTTCACCGACTCATTTGCCGCCTTC
GAGGAAATCCGGATGGAGTACTATTCCAGAGAGTACAACTACAATGAGCA
CTATTTCATATTCCTGCAGGCCAGAGATCGTCTGCTGCAGGGCGAGATGC
GGCTGATCTTCGACTACTGCTGGCGCTATCGGCTAATCCATTGCAGCATC
CAGGTGCAAAAGTCCAACGGGGATATCCTATTCTATAGCTACTATCCCTT
TGGAGAGCATGGCTGTTCGGATATGGAACCGCAGCTAATCAATCGCTATA
ATGGCAGTATGCTGGTCGAACCGGATTTATTCCCTCGCAAGTTGAGAAAT
TTCTTTGGGTGTCCCCTAAGATGTGCCCTTTGGGATGTTCCTCCCTTCCT
TACATTGGATGAGGACCAGGAAGAGGTACTGCGGGTCAACGGTGGCTACG
AGGGTCGGTTGCTCCTGGCGCTAGCCGAAAAAATGAATTTCACAATTGCT
GTGCGAAAGGTGCATGTCAATATGAGGGACGAGGCTTTGGAAATGGTGAG
TCCTTTCATTTTCCAAGGAACATATTTTTCACATTTCACATATTCCAGTT
GCGACGAGACGAGGTGGACTTGACTCTGGGCGGGATCCGCCAGACGGTGG
CCAGGGGCATGGTGGCCACCTCGTCGCACAACTATCACCAGACCCGCGAG
GTTTTTGGAGTCCTTGCCTCCAGCTATGAACTGAGCTCCTTCGACATCCT
CTTCTACCCGTACCGCCTACAGATCTGGATGGGAATCCTCGGAGTGGTGG
CCTTGTCCGCTCTTATCCAATTGATCGTTGGCAGGATGTTGCGCGAGCGC
ATGGGATCGCGGTTCTGGCTTAATCTGGAGCTAGTCTTTGTGGGCATGCC
GCTGTTGGAGTGTCCCAGATCGCACACCGCTCGTCTTTATTGTGTCATGC
TGATGATGTACACCTTGATCATTCGGACAATCTATCAGGGATTACTGTAC
CATTTGATACGAACGCATCAGCTAAATCGTTGGCCACAGACCATTGAATC
ACTGGTGCAAAAGAACTTCACCGTGGTGCTGACACCCATTGTGCAGGAGG
TGCTGGACGAGATTCCCAGTGTGCAGCACATGAGATTCCGCCTGCTGGAG
GCAAACTCCGAGCTGGATCCCTTGTACTTTCTGGAGGCTAATCATCAGCT
ACGGCAGCATGTCACTGCCTCCGCTCTGGACATTTTCATCCATTTCAATC
GCTTGAGTGCGGATAAAGTGCATCAGAGGGGCGAGCAGGGATCGGGAGCT
CACTTCGAGATCGTTCCGGAGGATATCATCAGCATGCAGTTGACGATGTA
CCTGGCCAAGCACTCCTTTCTCATCGACCAGCTCAACGAGGAGATTATGT
GGATGAGATCAGTGGGTTTGCTCTCCGTTTGGTCCAGGTGGGAATTGTCC
GAGAGCTATTTGCGCAACGAGCAGAGCTTCCAAGTCCTCGGCACTATGGA
GCTATATGCCATCTTTTTAATGGTCCTGGTTGGCCTGATCGTTGGCCTGC
TTGTCTTTATCTTGGAACTTGTGTCAATGCGATCCATCTATTTAAGGAAA
CTTTTTACGTAGTTTTGTACTTAAAGATAAATTTAGCTAGCTATATTTCG
TAGAAGTGAATAAGTAGCTTTATCTATATCAGAATTCAAGTTATTTTATT
ACAAGCGAAGTTATAAAACGATTTACTTTCAATTATTTATTTTTTTTTAA
TGTAATTAAAATATTGTATAATTTAATTATTTGCGAATTTCTTAGATACA
GCTAAATTATATTTCCAAGTGTGGGTGACTGTGGCAGGCGTGTGGTCTCT
ATAGAGGTCAGGACATTATCCAGCTATTTGTAAACCTCTTACGGCCGACA
TGGTGCTCGCATGAACCTGACACTGACGGGGTGTTACCGGCAGTATCCAC
ACACCCAACTAGCAGCTACCCGCCGACCCACTCCACCCACTCCACCCACA
GGTGTGTGTGTGTGTGTCTGTGCCGCTGATGGTGTTAATTTATGGTTATG
CGCCTCATGCATAATACTGACACCCGAAACCTGTCACGCACATGCCTCCG
GAACGGTTCAGTTGGGTGGGTTGGTGCTGGTTGGCTAGATTCCTGGCTGG
CCCGGAATGGTGGGGCGTTTGGGTGGTGGCCATGGGTTGCTCGCCCGTAC
GCAGCAATTAGTTTAAGTGATGAACACAGATTTGTTAATGCATTACCGTT
ACAGGCACGTTACTAGAATTAATTTGAATCGCTCGGGAAATTTAAGTAAC
TGGCATGAAACTATCGTTTTAAGTTAAATTAAAAAGGCTAAAATAATGGC
TACCTTATTTACACATCAATGCAAGGGAATTAGAAAGTACATTTATAATT
TCTTTGTGTGTTATACACTAATGAAACATACTGTATACTACTGTATGCAT
TGCAGATTTTTCCAAATTGATAGTGCAGCCCCAAAATCCCTGAACAAAAC
AAATCTAGTCCCTTGGATGGCGAGAACTCAATCAAATAAATTCGCAAAAA
TGTTGCCAAATGTTTCACATTCGCCATGGACATTCGTTGCGTTGTGGCAC
TGCTCCTGGGTCTTTGTAAAGTGCAAGCGGTTGTGTGGCCCCACCAACAT
CTTTTGGAGGAGCAACTGGCTAGCCAGATTTCCGCTACTCTGCAAAAGAT
TTTCATCAATGGGCTTGCGGTTTATAATTTTGGTGTTTTTATCAGCACCT
CCTACGAGGAAATGGACAGGGATCGGGTGATTCTGGTGCATCAAGTCCTA
AATCGAAATCTATATCCACCGAATTTCCCAGTGGCCGTTGTCCTGGCCTC
CAAGATGAACCGAAAGATAACCGCCCAAGTCTTCACGCAGTTGCTTTTCG
TCCAGAATGCTGAACAGGCCATGTAAGTTGCAATGTATTATTACATAGGC
ATAAAATATTCTAAAGTACATATTACATAATAATTGAATTTAGATTTGAT
TTCCATTTCAGTGCCATTGCCGAAGGAGTGAACAGAAACGGGCTCTGCGT
TATCGTATTGCTGACATCCCAGCCGGAACGACCCATAATGACGAAGATAT
TCACGTATTTTATGCAGGAACGTTACAACATCAACGTGGTGATCCTGGTG
CCCCGCTTGCACGGAGTCCAAGCCTTCAATGTCCGGCCATACACACCCAC
GAGCTGTTCGAGCTTGGAGCCCGTGGAAATTGACATAAAGGATGGCGATT
TATGGGACGTCTTTCCGAGACGATTAAAGAACCTACATGGGTGTCCATTG
AGCGTTATCGTTTGGGATATACCGCCCTATATGAGAATTAATTGGAAAAG
TAGTGATCCGATGGACGGACTGGACGGATTGGATGGGCTGCTTTTGCGGA
TCGTGGCGCGCAAAATGAACTTTACGCTTAAATTGATTCCCAATGAACCG
AATGGACTAATAGGTGGTTCCAGTTTTATGAATGGCACCTTTACGGGAGC
CTACAAAATGCTTCGCGAGAGAAGGGCCAATATAACCATAGGATGTGCTG
CCTGTACACCAGAAAGATCCACCTTTTTAGAGGCCACGAGTCCGTACAGC
CAAATGTCCTACATAATCGTGTTGCAGGCCAGAGGCGGTTATAGTATCTA
TGAGGTTATGCTGTTCCCTTTCGAAAAATACACCTGGCTGCTGCTTAGTA
CGATATTGGGTCTTCATTGGATTGTGGGCAGTCGATGGCGAATGCCATCC
CCCATTTTGGCCGGTTGGATGCTCTGGATCTTTGTCATTCGGGCCAGTTA
CGAGGCATCCGTATTCAACTTCATACAGAACTCACCGGTGAAGCCATCTC
CTCGCACTTTGGATCAAGCTTTGAGTGGTGGCTTCCGTTTTATCACCGAT
CATGCCTCCTATCGGATGACCCTGAAGATACCGTCTTTTCAGGGCAAGAC
TTTAATATCCGCGGGACAGCCGGTGGATGTATTTGATGCTCTCTTGAAGG
CTCCCTGGAAGACAGGCGCCTTTACCAGTCGCGCCTTTTTAGCCGATCAC
TTGGTTAGGCATCGGAAACATCGCAATCAGCTGGTGATTTTGGCTGAAAA
GATCGTCGACAATATGCTTTGCATGTACTTTCCACATGGCTCCTATTTCG
CCTGGGAGATCAATAAATTGCTTTTCAACATGCGTAGCTTTGGCATTTTC
CAGCACCATTCGCAGATCCTCGCCTGGGACAATCTGCCCACCACCACGGA
TACGGATACGCCGGGTAAAAGAATTCATTCCTCTACGGAGAGTGTAGCCA
CTGGATTTGCTGAGTCCATGAGCTTCGTTGTGGCAGCACTTAATTGCTTG
ATGGGAGCACTCTGTATTTCCATTGTGGTCTTTGGTCTGGAGTTGCTGAG
TCGAAGACGCCACTGGACGGGATTAGAATGGCTATTTGAAAGAGTTTGAG
TGGTATTAAATTATTCTGAAAAGTATATGGAAAAAAATATAAACATTTAT
ACTTAAGCCGCCGAAAATAACTATTATGTTTCGCGCCATTACTTTTTATT
GACATATTGTTTTTGTTTACCACGCCTTAAATGTATTTAAACAAATTAAT
ATGATTAATATATTATGCCGCATATCTGTTAATTACATTGAAAGCCCTGC
GTAATCTTCGATGATTTGTGGTCAAGATCTCCAGGATGAAGACAATTAAG
GCCACAAGATATAGCCCTGCACAGCAAACAAAAATTCCACTTAGTCGCCA
GATGGACAATGGCTTGGGTTCCAGGTTCCGCCGCTTGGACACTCGTTTAA
TTCGGTCCATATACATCTTTCGATAACGGGCAACGATGCCTGATGACATC
ATGGCCATGATTAGACGATCGATTCGCCTCTTGAAGTAGGAATGCGGTCG
CATGTAAAAGGTTAAGGGGGCGGTCATCAGTGGATCGGGAAGGACGGTAA
GGTGCCTTTTATTTGGTCCCGAACGAAAGTCAAACTGGTTGACAGTGGGC
TGTAGAAGAGCCACTGTAATACCTGGGTCATCCTCATCACGTAGTCGGTA
CAGTGACTCCTCAAGTGAGAGCACCGCATGGAAATTGGTGGTGGGCATCG
AATCCTTGAAGATCGTCCGCAAGGCGGGCAGAATACGGAACTCATAGTCC
TTGGCCAGCACCTCGCTAAGGGACTTAATTGGCGATCGCATTTCAACATC
CTGGAGGAGAAGGTATAACTGACCCGTATAGGCGGCCCGGAGAATCAGCG
TTTGCAGGAGCCACATCACCAGAATGTATCTGGCAAAGTTCCTTTGTGGA
TTATATAAAGCCAGACCGCCAAGCAAACTGGCCCACATGCCCATAAAGGG
AAGACGATTGCGTCTGCCCAGCACTAGATTTCTCAATCCCGGCAAAGCCG
TAATTTTCAGAAGACAAATCAGCACGAAACCGAAAATCAGGCTAACCAGG
ATGCAGGACCAAATTATGTAGCGAAAGGGTCGTGTCAATCGGCCCATTGG
CGATATGGATCCCCCACTCGGAACTACAAGGACAATCGGGAAACTTGTGT
ACGATGTACTGGGTAGCATCAGATCCGAACGGGCTTTGCTGTACATAAAG
CAAACGAATGTTAGATTCACCTCGCCATCGACCATCTGCAAAGGAATACG
TATACTTAATAAAAATAATGGTTCATTACGTATACGACCGGTTACGGTTA
CGATTAAATAAGTGCTCTTAATTAATCATACCATTTTTAGGATTCCCGTA
AAATTTCCATCAGGCAAAATTTCGCCGCGGTTCTTATCCTTTTGCTCTAC
CAATTTAATAGTAAAGTTCATCCGCTCGGCCAGGGATCGGAAAATCAAGC
CTTCGATGCCATGAATGCTTCTGCCTCCCGGAGTCTTGGGATCATCTTCG
ATGATCACATATGGCCGATGCTCAAAGGTTGCAACCACCATTTCACAGCC
ATGCATGTTGGTCAGTTTTCTGGGGAAAAGCGGCTTGGTAAGACCGAATC
CGTTCGCCGGTGCGGCTAGATCCTGGAAAGCAGTATAGTAGACAGGCAGC
GAGGACTGACAGTGATGCGGTCCATAGGGATAGTAAGTGTACAAATGGAC
CGTTCCATCTCTTTGCAGAAACACATTCACATTCAGCACGTACATATTTA
GCAATCGTCGAAACATGATCTTCAGTGACTCCATGGGCTGATCCTCCAGT
CCGGTGTAAATAACCAGAAAGAAGCCATTTCTCTTGTACGGACTGCCCAA
CTGATTCAGGTACATCTCCAAGCGAAAGTATGATCGCAAACTGTCCAGGA
ACCAGATAGCAATGGGTCTGCCCGTTAATCCACTTGGAGGTGGCGGATCC
GTATCGGTTTCCGTCATCTCCACACGGTCATCCTCCAGCAGAAACTGAAT
TCTTCCCGTGCCCGATGATCTGCCCAGGGCGGCATCTATCAGATCGTTGT
GCAGTCTTCTACTTTCCCGACTCGTGGGGAATTGCACCACAGCCAGTGGT
GTGCTGGTGGCCATTCCATAGTAGTTATCTATGGCCCAAACGAGGGCGTA
AACCAGGCTCACATTGTGCACGGCGCTGTGCAACATCGTGTTTCATCGGT
GGCTCCTAGCAAACTGATGTCCTGCACTTTGGCCAACTCCATCGCATGAC
GGGTTTGCAACGCTGGAAATATTAATTGATGAGTGTGATGCCAAAACATT
CTGATTACTAAAGGTTTTACATCGTAGAAAAAGTACTACTCGTAAATATT
GTTTCATTATTATAATAATGATTTTTGTAAATAATTTGTTTTATGCATAT
TTGAATAGCAGTTCTCATAACACTTGGCATTTTTTTCTGTGCATCAGCTC
GTTACTAGTATCTAAACAGGAATCACTTAACTGACGGGTCAAATTGCGTG
CTGAAAGCTCTATCGGCGAAATCTGAAAATGCAAATGCACAATAAATTAA
CTTTAAATATATAAAATCCAAAAAGCCGTATACACATCGATGTTTATTGC
TTTCACATTTCTTGTGTAAATACAAAAAGGGCACGGTAAATATACTTGAA
TGTAGGTTATGGAAAATATTTGATTACATTGGCAATATGCCAATAATTAC
TAAACATATTTTTTAACACCTTTGCATTGCTTTTTTTTTTTTTGCTTTTT
GACAAGCCTGACATAATTTTGCAGAGCTCAAGGGTTATTCAAAAATAAAT
AAAAAAAAAGAGTTGTAAGATATCAATTATAGTCAAAAAATGTATTTGAT
TCTTTGCCATACAAAACCACACCTGTGTTGTGAATAATATTAAGATTTTA
ATTCAATGAGTTTTTTCTTAGGCAGCTTACGCATTTCAGTCGCCGGAATC
GTGATTAAATGTGAGATAGCTGCGGCTCATGAGTAATTTTATAAAGATCA
GAGTCTGCGTTAATCCGAAACCAAATCGGAGCCAGCCAAAGGTCGCTGTA
CCGAGTTTCGTTTCGCACTTTTTGCTGACCTCCACAAAAGCCACCCGCTG
CGATGACAGAAGCTTTTGTTTCTCGTGTCGTGTCTACAAGCTGAACCACC
GCTGACCTCAGCAAACCACGGTGGTGGTGTTGGTGGTGCTTCTGGTGACA
CATAAACCATAAGACGATCGCAAGAATTCTACGGATCGACGCTTGAAGGG
CAGACACACCACGGCCCTCAACAAAAATCAGGGGCGGATTGCGCTGCAGT
GTATTTCTATCTTTCATAATGACTCTTTAAATGTTATAATATTACCGTTT
CCTTAAAGAAAGTTTTTGTTTAAATATTTATTTCAATTGTTTGTTTTTTT
TTTTTTTAGTTGAGAATTATTAGTGGCAAAAGAGTGACGTGAAGATAACT
TCCCCTATTGATTTCGCGGCTTTGTGGTATATTTTCGGCGCCTTCCGTGT
GATTCCAGACCTGATTTCGTTCATACTGTCTACTGTGCATCATTTGCGCT
GAATTCGTGGAAAATGGTGGTGAGCGGAATAGTTGGGCAAGGTTTTTTGC
AGCAAATGCAGCTGCGACGGCTGCTGCGGTCTGTTTTTCAATTGGGGGCA
CACACACGGAAACACTGGCCGTACCCCGGTGCGTGTGGCGGACCCGGGTC
CGGGTCACGATTTTGAAGACGTCTGCAGTTCTTCGCCGCCGACGCGGTGG
CAAAAAATCTATTTGGACCACTAACCGGCGGCAGTCGGCAGTCAGTCGGC
CAACGAGCTCCGGCGAACACAGATCGATCTTTAGCGATTTTTCCGAGTTT
TGCCCAAATACAGGATGAGATTGTTTAGCCTTCTGCCGCTCCTGGCGCTT
CTTGTCGTCCAGGCTGCCGGACAAAGTGAAGTAACCTCTGATGATCCTGC
AACGGATGCTGGATCAACGACCAATTCCACCACGGACACCAAACCAAGGA
TTCCCAGTCAGGATGAGGTGAGTACGATTAGAGAGAATTAATCATTGAGT
TTGTTTAATGCAATCCTCTTGATTATATTTTTCAATTCAGATCCTTGGCC
AGATGCCGTCCATTAATCCCATCCGCACTGGCAATCCCCAGATGGACGCA
TTTTACATGATGTTCCCGGCGTTGGGCAGCCTGCTCAAGTGGGGCAGCCT
TTTCCCAGCCTACTCGATTCTGGGCGCCATTCCCGACAATCTACAGCCTA
CAGCGGCAGCCTCCAAGGTGGTCCTTGTCCTGGCCGATGATGCGACGGCC
AAGACTCGAGTTGCCCGTCAAAATCCGCCACCAAATCCACTTGGTCAGCT
AATGAATTGGCCCGCTCTGCCGCAGGACTTCCAACTGCCTTCCATGGATC
TGGGACCGCAAGTGGGCTCGTTTTTGGCCCAACTGCCTGCTATGCCTACC
GTGCCTGGTCTTCTGGGTGCCGCTGCTCCAGTTCCTGCTCCAGCTCCTGC
TCCCGCTGCTGCTCCTCCTCCGGCGCCAGCTCCAGCTGCAGATCCTCCGG
CAGCACCTGTTCCAGATGCACCCCAACCAGCCATACTGGGACAAGCCGCT
CTGCAGAACGCTTTCACCTTCTTTAACCCGGCTAACTTTGATGCCTCCAG
TCTTCTGGGCCAGAGTGTACCCACATTTGCTCCTCCAAATCTTGATTTCG
TCGCTCAAATGCAAAGGCAATTCTTCCCAGGAATGACACCGGCACAACCT
GCTGCCGCTGGCACGGATGCCCAGGCCTCCGACATTTCCGAGGTAAGGGT
ACGTCCTGAGGATCCGTATTCGCAAGAGGCACAGATGAAGATCAAATCGG
CACTTGAAATGGAGCAGGAGAGGCAACAACAGGCTCAGGTCAAGGATCAG
GAGCAAGTGCCTCTCCTCTGGTTCCGAATGCCCACAACTCAGAATCAGGA
TGCGACTGAAGAAAAGACTCTGGAGGATCTGCGGGTCGAGGCCAAATTGA
GGGCATTCGAGCGCCAGGTGATAGCCGAATTGAGAATGCTGCAGAAGATC
GAACTTATGGCTAAGCAGATGAGGTCCAGCGCCGCAGCTCAAAACGGAGA
TTCACCCTACAGAATCAGTTATCCACTGAGTCGGACACCCATTCACAAGA
TCACCCGTGCTGATATTGAGCAAGCCCTTCGGGATGATTATGTCCGCCGA
TTGGTCAACAAGGAAGCGCAACGAAGGGCTAGAAATTCCGGCATAAACAC
CCAGAAGGCAAATGCCTTGAAGCGACAGGCCAAATCCCAGGATCAGACTC
TGTCCAAGGAGGATATCGTCCAGATTATGGCGTATGCCTATCGCATGGCC
AACGAACAGATGGAGAGCGAGAAGGGCAAGCAGGACAAGGTTTACGCGGC
CTACAGGACGGAACAGAATCCAATGATGATGCAGCAAAGACAATGGTCGG
AGGAGCAGGCCAAGATCCAACAGAATCAACAGCAGATCCAGCAAAATCCA
ATGATGATGCAGCAACGACAATGGTCGGAGGAGCAGGCCAAGATCCAACA
GAATCAACAGCAGATCCAGCAAAATCCAATGATGATGCAGCAACGACAAT
GGTCGGAGGAGCAGGCCAAGATCCAACAGAATCAACAGCAGATCCAGCAA
AATCCAATGATGATGCAGCAAAGACAATGGTCGGAGGAGCAGGCTAAGAT
CCAACAGAATCAACAGCAGATCCAGCAAAATCCAATGATGGTGCAGCAAA
GACAATGGTCGGAGGAGCAGGCCAAGATCCAACAGAATCAACAGCAGATC
CAGCAAAATCCAATGATGATGCAGCAAAGACAATGGTCGGAGGAGCAGGC
CAAGATTCAGCATGATCAACAGATGGCACAACAGATGGCACAGCAAGGTC
TCATGATGACGGAGCAGAGGCAAAGGCAGTGGTCAGAAGATCAGGCCAAA
ATTCAGCAGGCTCAACAGATGGCCCAACAGACACCCATGATGATGCCACA
GATGCAACAAAGGCAGTGGACAGAGGATCCCCAAATGGTTCAGCAGATGC
AACAGAGGCAGTGGGCAGAAGATCAGACCAGGATGCAAATGGCCCAACAG
AATCCAATGATGCAACAGCAGCGACAGATGGCAGAGAATCCGCAAATGAT
GCAGCAAAGGCAATGGTCCGAGGAGCAGACCAAAATCGAACAGGCTCAGC
AGATGGCACAACAGAATCAAATGATGATGCAGCAGATGCAGCAAAGACAA
TGGTCGGAGGATCAGGCCCAGATTCAACAGCAGCAGAGACAGATGATGCA
GCAGACCCCCATGATGATGAAGGAGCGCCAGTGGGCGGAGGAGAACCCCC
AGTCTGTCCAGCAGCAAGGGCCCATGATGATGCAGCAGCAGATGCCATCG
ATGATGCAGCGTGAAGTAGAGGACGAAGATAATAAGGCAGAGGATGACTT
AGTTGGCGAGGCGGGACCCCAAATGCCGGAGAACGAAGGCACCGCCAGGC
ACAAAGGTAATCTCTTCGGAGTCTTTCGCAATCCTGACTCAGTGCCATCT
GTCTCTCCCACAGTCGATGCCCTGGGAGTTGGCGGCAACAAGCGCAAGAA
GTCCAAGTCCAAGTCGGCGCCGCCAACGGTAATTAACTATTACTATGCGG
CACCCCAGCGTCCGGTGGTTCAGAGTTACGGAACAAGCTACGGCGGAGGT
GGCTATGGATCGAATGCCTATGGTGTTCCTCGTCCAGTCAATTCGTATCA
AAGTCAAGGCTACAGGGCTGCCGTGGGTAACGATGAGGTAGATGAGATGT
TGCGCCAGCACCAGACAATGGCCAGGGTAAGTTGAGATTAGTGTTAAACC
ACTCGGATATACCAGACACCACTACAACCACACCACATTGAGCACCACAA
CCACACACACACACAAACACACACAGCCATACACTGGAACATGTAGACAG
TTGCCTTCATTTGATCCATTTCATACGATTCATTCGCCTTTTTCTCATGG
CATTAAACAGGCGACGCATTTCAGACAATAAACCCGAAGCAACCAGGCGA
AGTCGGTGGATCGGAGAGCCAGAAGAGCAACTCTAATCCTCCAACGACGT
TGACACCAGCTCCACAAGAGCAACCGCAAGAGCATCGAGTCCACAAAAGG
TTAGCACATTTCCACAGGTTTGGGCGAGAGGCAGGGTTAAATGCGACCAC
ATCCAAGGGTTGCGGATGTGGCAGGTTGGATTGTCTGTGCGGCAGGAGTT
GTCGATGCGGAAGAAGAGGCTTGGAATCTAGAGTGGTTTCTAGTAGAACT
TCGGGAACTTGCCAGTGCAAAGCCAGTCACCGGAACAAGCGTAGCGTTGA
ATATGGAACCTTGGAGACCATCGATGAGGGTTCTCTTAACGAACTTAGAA
GAGAATATAAACTGGGACTAAAAGAGATCACGCTGAGTCCAGATGAAGAT
CCCGCCGAGGCCCTGATGCGCTACAATGCGGCCTCCATTCGCGAAGCTTT
GGAGCGAGCCAGTATGGAACCGCTGGAGATCGGTGGGGATCAGTATGAAG
AGGATGCGCAACAGGAGCCCATGGAGGAGGAGCAACTACAGCATGATCCC
AACACAGAGCCCCAGTACAATCATAAGGACTTTGTGCGGCTAACCACTTC
CACAGCATCTCCGATCACAAGTACCACAGAAGCTGCCACTCCAACAGGCA
GTGACTCTACTTCAGAAGCAACTGTGACACCTGAAGTCACCACCACCACT
AGCACATCCACAACAACAACAACCGAAAGCACCAAAGATGAGGGACTGGA
CATGCAGCAAGACTCACAGGCTGAGGCTGAGAGTTCTCATGTCACCAAGT
CGATATCGAAGCAGGAGGCCGAGATTCATCAGCTGCACAGTATTGTGGAG
GAGCTGAAGAATGAGATCCTTAAACTGAATTTGCGTTGCAGCACGATAAT
ATCAAACAATGTGGCCAAAGAACCGGTCACAGAGAAGAACCCACCCGTGG
TGGAGGAACCATCCAAGCAGGAGGATAAGCCAAAGGTGGAGGAGAAAGTG
ATTGCCGAAGAGCAAGCCCCAGTGGAGCAGGAGGAAGAGCTGGAAGAGGA
CGAGGATAGTACCTCTATTAGTACGACCACAGAGACTCCTTCACCAAGTG
GTAGTTACTCAACAAAACCTGGACTTTCCCTTGGATCGCCTAGAGTGGAT
GAACAAAGTGGCTCGTCCAATAAACTGGACTACGACGACGATAACAATTG
GCAACGCATTCTGGCCAATCGTGGCTATGACACGGACTACCTAACCAAAT
CCCATGAGCGTCAGTTTGCCCAGGGTCAAAACCTGGAGATGCCCAAGAAC
TGCAATTACGATGGAAATGGCAGCCAAGAGTATGGCCCCTATCCGGAGTT
CCAAGCAGATGAACCCAGCACGGATACGGAGGGCAAGGCTAAAAGGGCTT
TAAGTGTGAAACAACAGGCGCAGCTGCTCAATGCGGCCCTAAATGATAGT
GGAAGCGATTCGAGCGATGGCACCACCACCACCACCACACCCTCTCCGTA
CGCGATGAGGGGAAAGTTTGTGAGACGGAGGAGCACGGCAAGAAGGGTTC
CCATTCCAAAGATAGGAAAGGCGAGCGACGAGGTATGGGTACGATCTCCT
CGTCAAGCGAAAATGCCCCAACGACCCAAGAAGTCCATGTCCAAGCCGAA
AAAGCAGAGCTCGCAGGTGACTACGCAGGCCACCGTGAGCAGCACTAAGC
TGGACAGTTTGGTGGATGTGCTCAAGGATCTGGTGCGCCTGCAAATTCAA
AAGGAGAAAAAATCCAGCCTATTAAGAACCCAGAGCAATAACCTTTCGAA
AACCAAACCCAAATCTATTAAGCCCGTCAAAGTCATCAAGCGAAAAAGGT
TGCGCAGGAGGCAACACAAGTCTATTGCCACGACCATCAGGAGTCCCATT
CAAACGAAAGCATAAGATTTCAGCCCATTTAACTAATTCACAGATCCCAA
CTAATCCTATACATAATTTAGATATAGTATAAGCATATTCACTATTCGTT
CGCAATTCATTCATATCCATCCATCTTTCATTTGCATATCCCTCGTCCAT
ATCGCCAGTCCATCATCAGCACCATCCGAAACCGAAATCGAAAACGCACC
ATCATCTGACCCCCAAGTGGGTTCCATTTTCACCTACGGCGAGGGATTGC
TGCATCCGTTTATGGGTCTGCTGCCGGTGGAGAGGCCCGATGATCCGTGG
AACCAGAAGCCATACGATCCTCACCATCCTCTCTACACGGGCGGTGGGAG
CTACGATGCCTATCTGAGGGACGGTCGCCATCGAAGGGACACGCACATCA
TGGGTCAAGGTACGCAGCATGGCATCCTGACACCCGGCATGTTGGAGAGA
CTTCTTCGGATCAAGATGGATTTCCAGCGTAGATTTCCCCATTTGTACAA
GGGTATGCTGAATCACCATACGAATCTTACCCGTGTAGAGGTACAGCCTC
CGGTTCTGGGCAAGATTTCTAAGCCGAAAACTAAGACCAAGCCCAAGAAT
GAGGACGAACCCGTCTTCGAATTGGGAGCCGCTGAGCGTAGCCTGTTCGA
GGACGAGACCAACGATTCTTTAGAGAAAGATCCCGAACCAGAACCGGATG
AGGAGGATGACCGGGATGTGGAAGAGCCCAGCGAGAGCAGTGAACCTAGG
GGATTCAGCAGCAAAAAAAGCCGGGATGAGAACGACATCGATTACTTCAA
TTTCGATGACGATGATGTTGATGATTGACTTTTATTATAATTGCCAATAA
AAATTAATATTATAAATGTAGAAACAAGAACATTTTCCAAAAAAAGTAAG
GGCTATCAACTCTTTTTAGCCAGCCTATAAATCAGTATCGTTAACAGTAA
GTTAGTTTCCCAAGGGAATCGACTTTAATGTGATATGATTAACGCGATTG
GTCCGGGCCATTACCAAAATTTCCCCGGGGATCTGAAGACTTCAGTACTC
CAAAGTGGCCACATTAACACATTCCTTTGGCAACTCTTTAGCCATGAAGT
ACTGGTTATATATACTTTCTTGCTGCTCCTTGGTGGCCAGTACAATGGAA
TCCAGTTCGGATTGGGACTTGGCGGAAGCTCTGGCTCAAGTGGTGGCCAA
CTCGGAAATGGGTCGCTTCAAGACCTTGTACATATACACCCACACAAATT
CCCAGTCAACTGGTGGCCATTTGGAGGAGCTGCTTGACCAGGTGCTGATG
ATTGTGCCTAACAATTTGCAGGCACGTAGGCTCTTGCTCCAGCAGTCCAT
GGAGTATAAACCATATGTCCATGCTGTCTTGGCTCTGGTCGATGGTCTTC
CGTCTCTTTCGGCGATCTACGCTCGGATTCGAGCCACCCAGGATTTGTCG
CACACACTGATATACATGTCCATGCCCACGGATGCATATGGTGAGGAGAT
GCAGGCGACCCTTCGATTTCTGTGGCGACTAAGTGTACTGAACGTGGGCG
TAGTGCTGCGTCCACCTGGCGATCATATCCTCATGGTCAGTTACTTTCCA
TTCAGTGCGTTACACGGCTGCCAGGTAATCTCGGCCAATGTAGTAAATCG
CTACCAAGTGGGCACAAAACGTTGGGCTAGCCAAGATTATTTTCCTAGCA
AGTTGGGGAATTTCTATGGCTGTCTTTTGACCTGCGCCACTTGGGAGGAT
ATGCCCTATTTGGTTTGGCGTCCCGATGGCAGTGGCAGCTTTGTGGGCAT
CGAGGGTGCTCTGCTTCAGTTCATGGCTGAAAATCTAAATTTCACTGTGG
GTCTCTATTGGATGAACAAGGAGGAGGTGCTGGCCACTTTCGATGAGTCG
GGCAGAATTTTCGATGAGGTGAGTCTTGGATCTAAATCCAGGTATTGTTA
TACAATTTGTGTAATTTTCAGATCTTTGGCCATCATGCCGACTTCTCCCT
AGGTGGATTCCACTTCAAACCCAGCGCTGGCAGTGAGATTCCCTACTCCC
AGTCCACCTACTACTTCATGAGCCACATCATGCTGGTGACCAATCTGCAG
AGTGCCTACTCCGCCTACGAGAAGCTGTCCTTTCCCTTTACTCCGCTTCT
GTGGAGAGCCATTGGCTTGGTCCTGATCCTGGCCTGCCTGCTCCTCATGC
TGCTGGTGCGCTGGCGACATCACCACGAATTGCCAAGGAATCCTTACTAC
GAGCTTTTGGTCCTAACAATGGGTGGAAATCTGGAGGACCGATGGGTGCC
ACAAAGGTTTCCCAGTAGATTGGTATTGCTCACTTGGCTGTTTGCCACCT
TGGTCCTTAGGAGTGGCTACCAGTCGGGAATGTATCAGCTGCTAAGGCAG
GATACCCAAAGGAATCCACCGCAAACTATTTCGGAGGTGCTGGCCCAGCA
TTTCACCATTCAGTTGGCTGAGGTCAACGAGGCAAGAATCCTGGCCAGTT
TGCCGGAATTGAGGCCCGAGCAATTGGTTTATCTGGAGGGCAGTGAGTTG
CAATCCTTTCCGGCTCTGGCCCAGCAAAGTGGCTCATCAGCCCGGGTGGC
CATTCTTACGCCGTACGAGTACTTCGGTTACTTTAGGAAAGTGCATCCAA
TGAGCAGGAGATTGCATTTGGTTCGGGAACGCATCTACACCCAGCAGTTG
GCCTTCTATGTAAGGCGTCATTCGCATTTGGTTGGTGTGCTAAACAAGCA
GATTCAACATGCCCATACCCATGGATTTTTGGAGCACTGGACGCGGCAGT
ATGTCAGTGCCGTTGATGAGAAGGACGAGAGTGTGGCCAGGATAGCCTCC
ACATCTTATAGCACCCTCGATGGCATCGATGGCGACCCGAGTCTATCGGA
GTCGGAGGAGGACCAGCAGGTGGCTCCCGTTCGACAAAATGTACTCTCAA
TGCGGGAACTGGCTGCTCTCTTTTGGCTAATCCTCTGGGCGAATCTTGGA
GCGGTGGTTGTCTTCGTTCTGGAATTGCTGTTACCCAGAATAAAACTTAG
GAAAATATTAAGGAAAATGAAAAGTGACATAAAAAAGCAAATTTCTAAGT
TGGTTAGAAAATAGAGGCCCACATCGTTAATATCTAAAGAAAACACACAA
CATTTAAACAAAAGATCAAAAAAATAGTGTTGCAATTAAAATGAACGTGT
TCCTAATAAATTCGTATCGTTTTAACGAGAATAATACTGATATCCCTGTT
CAAAAAAGTCACATTCTTTCTGCTTGAAGACATTAATAATGCCAGATTTA
TTTGCGGGCCAGGCGTTTTAATTAAATTACTTCATAATCCACAGAGTCGA
CGAGAGCCAGTGCCACTACCACATCCACTCTGTCCTCCCCTTCCACGACA
AAGGACATCCCCTTCAGCTGCAAGGATGGCTTCCAGGATAGTTGGCCAAA
GTGTTCGCTGCTCGTATCGTAAAAACGCAAAACGTTTTATCTAAAAGCGA
TAAATTTTGAAAACCAAAACTTGCGCTGGCGAATCAACCCCCACCGATCT
GAAACCCCCTCCCCGTTCGCCGAATAGTTGTCCTTCAGCCGCCCAGCAGA
ACCCACCAAACCGAACTCCGAAACCCCAATCCACCCGCCGCACACATAGA
CATCAATTTTGTGTGTGCTTCTTGCCGGCAATCCTTGCAACATTTGCGGC
TGCCGTTGTCGCCATCGACTGGTTGGTTACATGTAAGTGCTGCCATTGCC
CCCTGAACCGACCAACCCGACCCCGCACTTGGCCACCATCCTTGGCAATC
TCTTGCTGCTTTGCTTATCGCCTCGCACATTTGAGCTTTTTGAAATTTCT
CGCCACAAAAACTGTCTGTAATGGGCACAACGTTGCCCGGCTTCGGTTTT
ATGCACTCGCAAAAAAATTTCTTTCTTCAATAAAGGTAAATATTTACGAA
TCCTATTGTGAACTTGATGTGTATGTATAAAAACTCGGACTAAGTTAACT
AAAAGCGCAGTTTGATAAATTCACATAAAATATTCGTATCACAAAAAGTA
TAGTTCTGCGTGTTGTTGCCTAGCTTCCTTGCCTTCCCTGTGCCCCCAAA
GTTTCCGACTCATCCTTGGGAGCCAACTAGTCAACGACATCGTCTTCGTC
CTTGTCGTTCGTTGGAAATTCAAGTAAATGTATTGAACTTAAGCTCATTG
CCTGCGATGTCGTTTTCGAAGCAGTCGCAGTCAGCGTCTGAAGCGATACA
TCCCATCCAGCAACTGGCGTCTGCCACCCCCATCTACATTTTCCATTTCG
CAACCGCTTTTCCACACCCCCCTCCCCCCCAAACCTCTTTAATACGCTGC
GCTGTTTAGGGAAAAATCAAGCAAAAAGGAGCCAAACTTTATGCAATTCC
TTTTATAAAATGTTTCCTATTTTTGGTTTTTATACATCATTCACAGGAGG
CTCTTTCGGTAAGAGCTTGAGAGAGAATTTCATGATGAAATTTAAAAGGT
TATGTGTTTCGAAATATTATATATTAATATAATTGCTATTATAGATGGAA
ATATGAGTTATACACAAAATTGATTTTTCCATTATATTACGAGTTAACAA
ATTCAAATGAAATGTTTTTGTCATAAGCCAACATCACTCATACGCCATGT
AAGCCGAAATAAATGATTTTTGCCATGGGTGCCTTGTCCAATGCCGCCAC
TTCAGCTCAACTTGCAGATCCGTTACCCAATTTTTTTTTTTTGCAGCTCA
GTCTGAACTACTCTCGGCAATTGCCACTGCCCCATCCACTGCCACTGCCA
CCGCCACTGCCACATCCTCGTCCTCATCTCCATCTATTGCCGCAATACTT
TGGCTCGTTTGGCAATGAATTTTTATGGCGCGACTTTTACGTCAGCATCA
TCCCGGGTACAGGGGCGTGGCTTCAGGGAGGGGCAGCAAAATGGGGGGAA
TGGTGAATCCTAGACCAAAAGTCTGAATCTGATGGAGCGGAACCCTTCAA
GGCGAGACATGGCTGCTCGCTAAACAAACATATTCATGACGAGATTATGC
TCGCCCATCCAAACCGCTGTTGCACTTAAAAATTTGCATTGGCAAAAGGG
GGCAACCAAGGGGTTGCGTACTAAAAAAAGGAAGCGGTATTGCGGATCTG
GTCTAGAAATTGTCCTCCTAATGGCTGCCCGACTGCAGCAACTGCCAATT
TCCGGCCGTGAAATTACATCTAATTAGCTAATCAACACAATTATGGTGCA
ACCTGCGGCCTCGCCCCCACTCACACACACACACACACACACATTTACAC
ACCAGCGGACAGGATAAAAGGACAACTGCACACATATACACTCGCAGGAT
AAAGGGACTACCGCGAACTCACACACACTTTGGCATGGTTGCTGCAACGG
AAGTTGGCCAGACACAGCAGCAACATCGACATCACCATCATCGCAATCGA
CATTCGACATCGACATCGGCATCGGCAACATTCGATGAGGAGGCGGCTTA
GGACCAAGTTCGCTGCACAGCCGCCACATCCGGCCACGCCCCGTCCTGCC
CACCTAAACGCAAAGCCCACAAAGGCAGCGGGAACAACCGCTGCACAATG
TGGCAAATGTTGGCCACTCATTACGGATTGCCGAGGTGCCAACTGGAATC
CCCCTGGCTGAATCTCGAATACACCACGTTCGAAGCACTTGATACAATTA
AGTTGAAAGAAGATGAAAATATGAAAATATATATTAAAATATGAATAGCT
CCATTACCAAACCCACTTTCAGTTCCAATCTAGGGCCGCAATTTGCAGGT
ATTATTCATGGTCTTGCCGTACATTTAATTGATAATCCCAGGGAGAACTC
CAGCTGCGATCCGCGTGTGAGTTCATTGATCCCGACCAGGTGACCAGGTC
GCCCGGTCAGCTGCACACATGTGGTCTCCACTCAATTATCCGGCGTACAT
TCGTTAGCTCATTACGGCTCCTTGCGCGACAGGAGCGCGTCGCGTCCTTT
GCCGGATCCTGCTACGTCTCCTGTTGCTGGTCATCGTCCATGGTTAATAT
CCTGTGTCAACTGTTGTCCATTCAATTTGCATTTTTGCAATTATTTCAAT
TAAATCGACAAAAGAAAAGCGTCTGCTTTCCGCAAGGCAAGGCGAGGCGA
GTCCGCCAAATGAGTCGATGATTGTGGAGCTGAAAGTTGGGGGCTGGAAC
GGGATCGGCTGCCCGGTGAGGAATATAATTTCCTTGCGCCGGATGTGACA
ATGAATACGCATTAATAAGTGCATACAAACGGGACACACACACTCTTATT
ATAAGGCAACAGTGATAAACGACGGCAGCATTAATGAATAAAAAGTAAAT
AATATTTATTGCTTACATTGAAATTTATTCTTAAGGGGTATGAAATATCA
GTCTATTATAATTATCCATGTAGTTAACATATAGTTGTATATTTCGTAGA
GCCCACAGTGCTGTGGGCTTGTGTAATTTATTCATTGGATTTTCTAGTGC
TTCACGCCCACGGTGGGATATGTTTACGATTTTTGAACTCCCGCCGAGAC
GAAGCGAATCAAATCGAACCGGGTCGCATTCTTTTGTTGCCACTGATGTT
ACTGCTGCGTGCCTTCCGGTGGATAAATTGATATGGCCCCAGTCGCCAAC
CTTCACCCACGTAACCGTCCAACTACCCAACCACCCAACCACCCAACCAC
AGACGCTGCCCATTCACACACAAGATGAACGGCATGAACGGAATGCGGCA
TGAATGGCGGGCTAATTTTGTGGAGCGCAACGGGCGGCGCGCTTTTAACA
ATATTAATATGCAAAATAAAATAAATGCCGGCAAATGAAGGATAAGCCGG
AGACAAAGCGCCGACAAGAAATGGCATAATAAAGGAATGAAGCTGGCAAT
TTTCATTCGCGCAGCGGGAAATTGGATTTGGACCACTCCGCCGGCACTCC
ACTCCACAAATGCGTCCGCCATTCGGTGGCATATAGTTTCATACATACAT
ACATACATACATACATACATATTGTACGCGCAGTCCTGCTGTCGTATACG
TAATATGATTATTACATGCTGCCAGGGTTGCCAACGCCACCGCAGTTGGT
GCGTGTCATAAAGATGAAATTATATGATTTGAATAATAATTGAATTAGAA
AATCACAGAGACGCATTCGGTACATGCCTGGCATTTTTCGACCCGCCATA
TGTACGCAGTAGGTGTTAATATATATGCACATTATTTCTTTGGTATAGAT
ATAGAAACTAGCAGCTTTGTTACGCAATCGATTAGCTGTGACATATCATC
ATAGATTCGTGCAATTAAATGCCATCAATTTGTGAAAACTAGCATCTCCC
AAGCCTGGGTGCATTATCCTTGGCCATTTGTTCGACTCAAGTGGAGGCAG
GCAGGCAGATCCTAGCTTCCAGATCCTGGCAAGTGGCGAGTGAAGTTGAG
GACTAGTCGCACGGTGGGCACACACACAGCCATTTACTGTTTCTTAATAA
TTTGCAAAAATGGTTTTAACCAAAATGGGTAAGGATTTGTGTATGGGTTA
GGGTAAAAGTAGTTCTAAAACGAAATGTTTCAGTGAGTATGTGTAGTGTA
TAGTGATCCTCTACCACTGTACCACTTGCCAACTATGTCTAATGCTCTCG
ACATTTGTCGCCTTCAACTGGTTAACAAGTTTCTGCAAACATCGACAGAC
ATCATTACTTACCACCCCCACTGCCATTCTTCGTTCTCCGCTCTCGGCTT
TCTCCGCTCCACTTTCTCCTCTCGCCACTCGGCTGTAATCATGTGAATCC
GCTTAAGCTGTCGAAGTGTATTGTGCGTCATTATTCTCTCTCGTGCCATT
AGACTTGAATAGTTTTTCCATACTAAGAAGTTAAAAGGAGCGCATACAAA
AAAAAAGAACACTAGAATGGCTAAGAAAGCGACGAACGCAAATCGCATCG
TCGACTTTGCTGCTCATCATTTGTTGCTGCACTTCTGCAAAAATATCTAA
AAGTGCACTGTGAAAAATTCCGACCTAGAAGTGCGCTTGTAAATTGCATC
TGCAAGGTGGCAATAAATGCAATAAAAGGCAATAAATGCCTTTTTAATTT
GTAAATATTTTGTAAGGAACTTTAAAAATAAACTTGACATTTTATTTAAA
CTATCGACATTTTTTTCACCCTGTAGAAGTGTCACTGTTCTCGATTTTGT
GCACTTGTGTGGGAGTTTGCTGCGATGCCCCCTTGATGATGATGACGACA
CTCGACTGCATTTCCACTTAAGTGTTCGCCTTTTTTTTTCGCACCATCAC
ACACTTTTCCGCTCGCACCACTCATTTTCCGCCATCTTGATCAGCTTGTG
TCTGTTTTTTTTTTCCGCATTCAACTGTTTTCCGTTTCAATTTATTTGGG
TTTTTATTTCATTTTTGCCTACAATTGTGGCCAATTTGGCTTAATTGTTT
TTATTAAGAGTTCGCCACGCCAGCACAGCACATCGCCCCATCACTCCACA
CACCCTTCGTTCCACAAATTTTCCGTCGCCCAACAATGCGTATAAATAAA
TCACTTGAATTTTATTGAGCCTCGCCTCTCGTTTTGCCGTGGAAAATTGC
ATTTTAAATGCATACACAAATTGAAAATTGCCATAATGCAATATGCACAT
GTATGTACGTGTGTGTGTGTGTGTGTGTGTGAATGGGCGAACTTTTGCTT
TGGTAAAACGTGCCTCATTATAAAGATCAATGACATGTCCCGAACAGATA
TTAAACGCCATTTGAATGTAAATTGTTGCTCTTTTCATTTTCATATAGGC
GTAGGCAAATGGTTCAAAATTTAGCATTTTAATGTAGTTAAAGTAAAGCC
CGGCCACAATGCGAGCCAATTTGTTTATTTACTTAACATTAATAGTAGTG
GTGTAGCTTAATTTAAGTGCGTATTCTAAAAATAGTAGTAAATAGAAAAA
AGTGTATAAATCAATATATTCAATATGCTAAAGCGTTACAAAAACTGAAA
ATTTGTATTTGATATTAAGCAGATGTGGCTCCGTCAAGGCCAAAACGAAA
GGAGAACTGAACATTTTTGAAGCTTGGGGTGCAAATCCAAATCGGAGCTG
AAATTGATGTTAAAATTATGGGCAACATTTTCGAATTTCAAGGCTCATTA
AAATTATCTGTAATATTTTCTTATATACACAGGAGTAACACGGGAATAGG
TTAGAGTTTGTACTGTGGGAATTCTTTCTTAGAGATAATTCCAGATTTAT
TTCGCATCGAAATTTTTGCATATCAAACTATTTAATTGACGATTTAAATA
TATACATGTACAAAAAGTTCGAAGACGATTTTATGCCACGCTACTAAAAG
GCAATCCATGTGAATACAGCTGCGAAGGATCATCGGCTCTTCTGACCCGG
CTCTTTGTTCTCGCATTGGAATTGCGAGGATTCCGGTGGCGTTGGTAGGA
TTGAATGGGAGTCGTCGGTCTTGACCAACAGTTCCGTCCGTTCCAGTTCC
TGATCGATTCGCTCCTTGGCCCGAAAGACTTTCGACTGAATGTAGAAGCT
ACCGCCGGTGGATTTGTCGTTCACACGAAACAAGTGCTGGTAGTGCGTAT
CTATCGCCTGGCGGTTGGTAAGGTCACTCACATCGAGAATCTGCTGGGCC
TCCGCCAGGGTCATTGTCTTGGCCACCGCACTCCTGCCGCTGTTGGGATC
GTTGGCCTTTAGCGTTTCCTGTAGGCGTGCCGCATCCTCGAAGGCCTGCA
GCTCCTGGCGCATCGTCTTTACCAGCGCCCGGCCAACCAGCTGGGCACCC
AAAATGATGATTTGCGCTAAGTACCGTGCCATTTTCTGCTTGTCTAAAGG
GAATTTTGCTCGCGATTGTGTAGAGATCTCCGAAATCATAACCTGAACAT
AATAAGAACTATAAAGTGAAAATGACTCGATTGCTTTGTGAAATCATCGA
AATGATCAGAAATATTTATAATGTTTTAGATTAAGAGAAAAGCATTGGTC
CAGTACGGAGTTTTATAAATTACCCATGTGCCCTTTTTCTTTTTTTGGAA
ATTACATTTTCCTTTTACAATTTGTGAAACTGTTTTCCCTGTGAATTGAA
CCTTTCTTATCCAACAACTTATAGAATTTAAGCCAATTTTGTTTGCCTTT
CCAAATTCACAGAAAATTGATTCACTTTATGTAAACAATGCGGCGTCTGG
AAACTCTTGAAAATGTTCGAATTAGTTTGTACTGATGGACAAATGCCTCC
ACACTTTTATTAAAGCATTTTAGTTTTGACTGAATTTGGTTTGATTTAAA
GTTGATGTTTTCATTTTTAATACACTTTGCCACATAGAATCACACCCGTT
GAACTCCTGACGCACTCAAGTGTCTAAAAACGAGTATGTCATAAGCTCAC
ATTTGTACAGCTGAGGTCAAAATGGTAGCAATTATTTGCAATTATTTGAA
AACAATATCAGTAGTAAAGTAAATTGCATTAGAGATGCAAAATGTACTTC
AACAACGAGAATATTGTATTGCAGAACAATGTAGTGCACAAATTAAGTTG
CCCAGCAGTTAAAATATTTGTGTATTATTTATGTATGTAAATTTATTTTA
TATAAATTGCACTTTACTCCAATGTTAAAATATTTTATTATTTTCACCAT
CTCTGTTCCTTAAGATTCAGGGAGACCGAGATAGCTGAATGAAATCAAAA
CGTTTCCGTGCTCTGATTTCCAGCTTCCGTATCCGTTCTGCAGGCGTTTT
TGCAGCTGTGTGCGTGCGTGCTTATGTGTGTGTGAAGCTCGTAAACAAAT
TATACGCAAATTGACAGACTTCCGGCCTTATGACCAGGCGGACATCAAGT
AGTTTAGTCTCCAGCATCTCCTGGATGCCACAGTCTCTCATTTACCCGGG
GCAAAATCTCTCCCCGGAATGTCCTGTGTGTGGTGGCTGGGGGGGGGGGG
GGATTTGGGTGAATATTAACATAATTACAATAATGACTTGTTGCCGTACC
CTTTACTACTGAGATATCCGCAATTTCCGAATCTGCCTAACATTTCCATG
CAGCCGTTTGGAGCAACATGGCAAGCTGCTGCAAAGATGGAGTTGGTAAC
CCTGGCTGGCAGAGTCGCCACCACCATCCATTCCCACCGCAAATGCACAA
CAATGGCTTTCTGGCCATTTGCCGTTAAAATTCACAAACTGTAATTGATC
ACATTTGCGTTTGTCGTTTGATTTCATTGTCTTGTGCGTGAGACCAAGTC
GGTGCCACCCCCACCATTTTCCCGCCCACTTTTCCCAATTCGGGAGCCAC
AGTTGATGGTCAGCGGCTGTTGTTGCCGCTGGTTGGGGCTCATTCATTAT
GCAAACACCTCGACATGGCTATCTAAACGTGGCCACGTCCGATGCGCTAG
GGAACACTTCGAAAAAATTAGGCCAAATTGGAAACGGTATTAAAAATCAA
AACATATAATAATACTAATACTAAAAAATGATTGAATGTAAGGATTTCAA
AAATAAATTATATTTTAATAGTCGGCAAATTGATAAATTGATCTCACAAT
TCTCTAGTATTGAAGATTCTAAAAAAAATTTATTTAAAATTACCATCTTA
TTGATAGTTTTTTTCTCCCTCTGTAGAAGAGCAGCCAGCCTTTTGCGATT
AGTTGCCATTTAAACTACTGTTACCGCCCCTGAATCCTCGTCCGATTCCC
ATTCCCAGCTCCATTTGATTCCAAATCGTTTGGGGTTTTTTCCGGGTGTT
TTATTTTTTTTTTTTCGGCGAATGGGCCTCGGTAGTGGACTCCATCCGTT
CGTCAGTTGTGTCCGATGGCTGGCCGCCATAGCATTTTGATTTCCGCACT
GCATCCGGCAGTTTTAATCCCCAGACGGCAGCGTTGCTGTACTCCAAACC
ACTCTGTACCGCCATCGCCAGCGGTACTCTTCCTAAAATGAAAAAAAAGT
TGAAGTGTAAATGCAGCAAGAAATTAAACAGAAAGTATAAGTCTAGATAG
CCTTTAATTTAGGTGCATTGCTATCCTAAATTTCACTGGCATAACTTGAA
AATATTGTTAAGACTTAATAGTCGTGTTCACAAACTATTTATTAGCTGAT
ATAACCGTTTTCGCATAGAGAACTGTAGCTACCAATGCGAGGGAGTCAGG
GAAAATGCGAACAGTTCACTATTTACCACACACGCAACGTGGGATCCTCT
GCAGCACGGTGGTGTTGGTGAGTGGGTGGAGCGGGTGGAATGGGTGCTCT
ATTGGCGGTGGCCATCGGTGATGCATGGCCATGGCCATGGCGCTGAAAAT
TCTACTGCCTGCCGTCCAGTTGGTCCGGCCATCCAGTGTCGCATTCATTG
CCATTCATTCGCTGCTGCCGTTCGTGGTTGACCCACCACCCACTCACTCA
TATGCCGCCCAATGGCACCACCACTCCCCTTGGGGATGATGCTTGCTGTT
GTTGCTTGTGGCTAACATGCAAGCTTAGGATTTGGAAAACAATTTCACTG
TTAGTGGAATGTCAACGTCAGGTCTCGCTCTGCCAACGGCTACCCCATCC
CCAACCCCGCCACCATTGCATGCCGCCCACCGCCCACCGCCCACTGACGT
CCACCTCCCCCTTTTGGTGGTCAGAAATTTTAGGCGCGATGCGTCGCACA
CATCACTAATTAGTGATGTGCAATAATCGTGCCAGTGTGTGGATGTGTGT
GGAGTAGGGCGATGGGTGGCTTAGTGGTGCAATGGTGCACTGGTTCAGTG
GATCAGTGGGTGGGTGGTACACAGAGGAAATATGCTACATACCTTGTATT
TTATTTATTTATTTTAATACAATCTCCAAACAACTTGAATATGTGAGAGT
TATTTCATTTGCATTGCATTTTTTCTTTAAGTGCACTTTAGCCGTGGGTA
AGATTTCGACAACGGTTCGGTTCAAAAATTGCGACATTGTTAATCAACTG
TGCGTGTCGTATAAGTTGCATTTGCTTTCGGTCGCTTGGTCGGAATGGAT
TGCATGCGATTGCCGTTTTGGTGGGTTAAGGCGGGGGAAAAAAGGGTTAA
ATTGGGCACTGGGTTGTGTGATTGGTTTCCATGCTCCAGAGAGGCCGAAC
CCAACTGACTCAACAGAGCCGGGCATCTAAGTGAGTGGAAATTTGCTGTT
GTGGGGCAATCCGATAATCATATGCATTGGGAATTAATTATTCTTGACCG
AGTTGAAGGTCGTTTTGGGGAACAATCGAATGTATTACTTTGTTATATAG
GTTTAGTAAAATATTAGCCCTTCATTATCGAAATTGCTGCTAAGCTTTTT
TGTTTCGAATGAGTAATGGTTTTTTTTTTTCGTCTATATTTATGGCTAGG
CAGGTCATGTCATATTTTCGTTACTGAGTTTTAAGCATTCTGTGCATTTT
ATTCGAAATTGGCACTAGGTTTTAACGGCTTTCAATGAACAAAATGCAAT
CTGACGGGAAGTGCAAAGGGCATGGCAGCGATGAAGCTGCAGAGTGCAGG
AGCAGCCAATATGGTTGCATTTAATTGACCAGAAAAACAGCAAAAGGGCT
GCGGGGTGAGCCTAATTGAAATTTCATGTTGCAAAAGTAAGTGAGAGCCG
TCGGCAGGGGAGGAAATCAATGGAGGCAAGTGTGAGCTGCCATTTTTCGC
GATTTGTTATCAAGTGGAGAAGAAATGCACAACTTGGGGCAGCTGCCATT
GCAAAGATTAATCCAATGAATAACAATTTATTTCAATGGAATTCTTTAAA
TAATATTTTAAATCTAGCCAGCCTTGGATACAATGTCAATTGTCAAATTC
TCTAAGGCAGAAGGTCGCCTATGAAAAATCAGTATATTCGAACTGAAACG
GCATTCGGTTCGATCATCAGTTATTTCAACTAAATTCGAGTTTTTTGCTT
TTGGCGAATTGAAATTGATATATCAAGAAAACGATTTGATATAATGGCCC
ACAGGGAGTACAATCGTCGTGATGGCCAGGCAGAGGGATTGGGTCTAGGT
GGTGGCGATGCAGACAACAGTGTGCGTATGCGACACCCCACCCCACCACC
GCTGGCGGTGCAGCATGCAAGATCTGGGGCGATGGTTGTGGAACTGGCAG
TGGACCCTTCCCGAGCGATGAGGTCGACCAACCAGCAGCAGCCAATTGAT
CGGGATCAGTTGAGGATCAGCACGGAGGAAAGCTGTCAGGGATCCGAGTT
GGTTGTCGCATCATCACATCTATCCAAAAAAATTCAAGAACATCGCCGAC
CAAATCAGCTGGTGCGCTTTTGCCTACGATTGGGCTACAACACCCTGCTG
TATCCGTACGAAATGGCCAAGGTTCTTATCCAACTGGGACATGAACCGCT
TCAGGCGAAGCCCTTTGTTATGCGACTGATTCAACGGCGGCCACGCCTCT
TTTTGCCCAGTGTCCATCGGTATGTGCAGCACATTCAGCATATAGATGGC
TATACGGGAATGTATCGTGGGTTGACCGCTCGCCTGGCCGCCAGCATAGT
AGACTATTTGCTTGGCGATCTTCTGCTGGCTACCTTGCACTTTGCACCCT
ATAAGAGAGGCCCCAAGGAGGGACTGAGCCTCAAGGAGTTCTGGTGGAAT
CTGACAAGGAACAGCTTGCGCATTACCACCGTAGTGGTTATAACACATCC
CTTTTACGTGGTTATGGTGCGCCAGATAGCCCAGTTTGTGGGTGGTGAAC
ACGTTTATGAGGGTCTCGTTGGCAGCCTGATGACTCTTGCACAACAGGAG
GGATGTGCAGGACTGTTTGCGGGCATGGTGCCACGCCTTTTGGGCGAGTG
GAGCGTCCTTTTCATTACGAGCGCTCTGAGTCACCTTTGCCGTCGTCTCC
TGCCAATGAGCGAACTCCAGCATCAGTATAACACCGCGGTAATTCAGATG
ATGGCAAGCCTAGTGGCCTATCCACTGGAGGTGACATCCACCTGCATGGC
CGGAACCGGAGCACCATTAACCGCATGTGAGCCACCGAGCATGCCGCTCT
ACAATCACTGGGTCGACTGCCTTACGGATCTCTATGCCCGCGGTGGCCAA
AACCGTGGTGCCATTCTCTTCTGGCGCACGGTGCCCAAGATCCAGTTGCT
GCGCAGCAAGGATAATTACACTGTAAGATCGATTTAAAAGAATATGGGGT
ATATCAGTGGAGGATGAAGAGTTCAGAAGTGGGAAAGAATCAATCGATGG
CAAGCACGGAAAATAGAATGAGATATGGAGAAAACGTATTTGGAACAAAC
TACAAACGAAATGAAAAAAGGCAAGAGAATATTTCCTGGAGCGTACATTT
TGGATCGTGAAGAAAATTAGGAGTTAGTTAAATTTACAAACAAGTCGGTG
GAGTGATAAGACCATGGATATTCAAAAGATTATAGTGTGAAAAACATTTG
ATACGAGGACTACAGAAGAAACACAGAACTGATAGTTTGCGGATATGTGA
ATAGCAGAACAACCAAAGGCAATCATCGTTTACTGATCTGTGCGAGAAAT
AATAATGTTGATAACTTTTGAATATAGTTACTGTTCATAATATTTGGAAA
TAATAATAATAAAAAAAATAATGTTTGGAATTTGGCATATTATTAAGGAA
ACATTCAACAAACACTTACTTACTTACTATTTGGTCCATGAAAAGGGCTC
AGATGGATGACGAGGCTGCTTGGCAAAAGAAAAGACCCCCAGTTGAGTTG
TAGATTTGCACATCCTCTTGTTGTTTTCGCATTCATAAGCTTGTAAAGCT
ACAGGACCGCTCTTTATCTGTATCTTTTCACTGGGGCTGCTGTTGCTGCT
CCTGCTGCTGCTGCTGCTGTTTCACCAAATGTCAGCAGAGATTAAGCGAC
TGAAATCCGGGCAGAATGGAACTAACCAAGGCCAGGACACATGTACGACA
TTCTATGTACTCCTTAACCCCCGACCCATATATGTGCATGCGTATGTGTG
CACATACATACATATGTACATATACGGTGCACATACAGTGAGTGCACACC
CACACAATGAGGCGTAACTGGCAGATGCACGTAATGAAAATATCAAAAAT
CTACAACGAAATGTGCCAACAGGATTTCAGTGGCCAGTGGCGTGCGGCAA
GGGGTGCGATAAGGGGGCGGTGGCGATGGCTCAGACACAATTCAGTTTTG
GTTCATTTGAATGCGACACATTTGCGGGCCACACTTCGGTGGGCAGAGGG
TAGCATTCCGGCACTCGGGTCTTTCGAAAGCTCAAGTGGTAAATGAGCTG
GATGCCACATTTCAAATATAGTAATATTTTTTTATATATTTCTTAAAATC
TTAGTTTAGAGGCAGTAAGTGTTGCACATATCGAATGTTATATTTGACCA
CAGGGTATTTCTTAGTCCAATGACTAATGGCAATCGATTATCTAAATGCC
AGTTATGCTCAGTTGTTGTTGTTGCAAGTTGGTCAGGTTCATTTGGGCCA
GAGAAATCAAGAGTCAAAAGTTGGACCTCCTACATCTTCCATAAACGTTG
CAAAATTACTAGTTATTACATGAGCGTGTCTGTGTGTGTGCGCGTGTGTG
TATGTGTGGTTTCTGTATGTCCATGTGTGAGTGTGTATCTGTGTGACGAT
GACAGTGCAGTGGGTATAAGTCGTATCGTCTTAATAACCAAAAAATGGCA
TCAGCCGTCAGCCTTTGCAGGACTACAAGGACTACGTGTCCTGCAACATT
CACGCATGCCTGCATATATATATATATGTACATATATATATATATATTGT
ATATGTATTTGGATGTATAGTGATTCGATATATCTATGTATGTATGTATG
TATGTATAGGGCTTCGTGTGTGTCTGGGCAACTGTTGAGCAGAACACGAT
TCTGTTGTTACTGTCGCCTAGCAAAATGCAATTAGACTAACGATGCAACA
CAATTTTGTCTTCAGCTTCATAAAGATGCGATGTTCGGGATAAAGGAGGC
GGCAATATTGGGCGGCCAGTTGACATAGTCAGATGGTCAGACGAAAATCG
AGGGGTTGCCATGGACTTCCTTGTTGTCATTGCAGGCAGGAGCATTAAAT
TGTTAAAAATATAAAAGCAAACAGCCACAACCAAACACTAGTTGGCTGGC
TATCTAAGTTATCTATACACTTTTGGAATTGCATGTTAATCTAATACTAA
TTTTGTATTTATTTCATTATAAAATGTTTTCAAACAACTAAATTGCAATT
GTTCTCGAACAAACCTCGCACATTCAGCCGAAGTCTTATGCCCAACAATT
TCATGTTTCAATTTTTGTTCATCTGTGTCTATGTGTAGCGGAAATGCTGA
ACAAAGTCATGCATTTGCATGGATAACTTGAGGCTTTGTCTTGGCCTCAA
CTTGCAAAACTGCTAGTTTCTGGGCCCAGAACTAATTGCCCTGCGTTCGG
GCTTAATTAACATTAATATCGAGTCCATTATTAAGTCAATTATGAATTAT
TATTGGAATCAGATCTGTATCCGTTTCCAAAACGATATGAATGTATACAT
TTATATATATATATGTATATGTGGGCGGGAATAGGAAAATTGGAGGGTAA
ATGTCATAATTAACACAAGCCACTAAATGCATGTGTGCGGTTCTCTTGGT
TCAGCTTGTTGTATTTCTTTTTTTTTTTTTGTTGGCTGCCAGTATAGGTA
ATGCTTTATTATTAATAGTCAGATATGTTCCACACAATAAAATCTCTTTG
AAATGACAGCAATAATAAATATCTATCTATATCAGAAAGAATATTAGTTG
ATGTAATATATATATATGTATATACATACTTCTTTGGTGGTTTTGTGAAA
TCTTTTGTTTGTAATTATGTGTATTAAAACGATTTCAGGGCTGGGAACAC
GTTCTGTTCTCATCACGATAGGATGTGCCACGGGGGAAGTCGACGTTTCC
CGGCGGTTCACAAATATATTACGCATACGCCGCATCGGCTTCCGACTTCC
GACAACAACGTCGGCGGTTTCAATTTTATAACGTTAAACCAATTAACAGG
TTTTACACACACAGACACACGCATTTATGAGGTGTTAATCGACGTCATTC
TGATGTAAAACGCGATGAGAAGCAATATATATTTTATGGGTTGCGTAATT
AACGGGCAACAACAATAACACACACACACATAACACACACACATACACAC
ACCAAAGAGCGACAGGTTAATGAGGCTCCATTGATTATGCATATGAGTTT
TGCGGGTGCGGAATGTGTGCGATTGTGTTGGTGCGGGAGGGGGCGGTACA
AGTGAGAGGAGGCGGGGCAGGCGAGCGGCGGCTTCCCACATCAAATTAAA
ATGTTACATATGCTAATGAAATCAACCAAAATTATGAGCAATTATGAATA
GCTTAATGGGATTGCCGATGACTGGCATTGGTTTCGCTTGCGCTCGATTT
TCCTCTGTTTATACAACTCATCCTTTGAGATGCTTTCTCCTTTGAGTTGG
CCCATAAAGCGTTTTTATTTAATCAGCACTTGCCAAGATATTTACATAAT
AGCGTATTGATTTATTTTATTTGATGCTATTTTTTTTCAGGATTTAATCT
CCTTTGGAGTATTTGTACAAGTATGTTTTTTTTTTTCAAATCTGACATGT
GGAATTATTGCGTTTGTTTATTTTACGCTCCCATTGACACACTTTCACCA
CTGATTTCTTCCTTAAAGCAAATTTTTGGACATGCTACTTTTTGGTGGGG
GGAAATGCCAGGTGAGCAGCCAGGTGTAAATTACAAAACTTGTAAGATTC
TCCATTTCCTCTGCGGGCGGGGCGGGGAGATGATGATGATGATGGCACTC
CCGGCACGACTGTCGTCATAGCTGGCTGCCCCGGATCTCGACTCGAAGGT
AATGCCAACAATTACGCAGCTGAATATTTTATGAGCCAAGCAGATTAATA
TGAATATTTTATTATCATTTTAGATTCCTTATTTCCCTTCTATCGCAGTC
CCATTCTCTGTCCACAAAAAGAGCAAGAAAGCGTGGGCCAAAACCAAAAG
GAAGGACCAAGTCAAAGTCAACTCAGAAATATGCTTTGTTTGGGTTTTCT
CTGTGAGGACACATAGCGAACCAGATGGAGTTACTTTTATGCAGCTTGTT
GCAATATGTGTGTCAAATTGTTAGATTTGACATTACATTTACAAGGCTTT
CCTAATTCAATTGAAGTCTTATCGACCATAAATATTTTTGCCAAAAAGCA
TGCTGTTTTTTTTTTATAATAGTCCCTAAAAGTGTCCCCATCAGTGCAGA
GCATTTAATGCTCGACTTTTTCTTGACGGAATTTAATTTTTAGCTGCCTT
GGCTGACTCTTGATGCTGCCACAGTTTTTTGCACCTTGGCAGACGAAAAT
GTTTGTGCCGGCCCCTTGCCAATGGCAAACAAAAAAACGGCAAGGAATAC
GAATAAATGAAAAACGCAGGACTCGCTGGGAAAGGCGGCTGGGAAAATGT
GGTGAGAACGGAATTTATGACCACGAGCCTTCAAAGGGCCAAGTTGCCTA
AATGTTTTTTTCTTCGCAGCGCCAGCTTCAGACAGGCAAATAAAAACGGG
CCAAAACAAATTGTGGCCCAGAGAGCCGGCCTCGTCCTTCGTCCTTCGCT
CGCGCCCCTCGACCCTCGTCCCTTTTTCCCCGTCCTTAATTCGCAGTCAA
AACCAGAAAGCCACTTGGAAATGTGTAGGGTGCAAAAAATTAAAAAAAAG
AGCAATGCTATAAAAAAAGTCGAAACATTTTCTTTCATTTGTTGCGTTTT
AAATTTTCATGCGCAGCGAGTGTCGGCAATTACCAAGGCCTAAACTATAT
ATACGTATGTATATAGTTTTCCGGGGGGGCGAGCCTAGGAGGCAGGCAAA
TAATAACGTCGTCATGTATAAATTGCCTGCCACGCCCACAGACGACTTGG
TGGCTTGGCGGGAGGCATCTCTGATTTATGCAGCCCATAAAATTGCCTGG
CGTGTAAAAAGTGGAGAAAGTCGAAGCTGAAGAAGTGCAGCAGCAGTCGC
AGCCGCATCTATCGAAGGGTAAAGGCGAGGGGGAGCAGTGCGTTGCGGGA
TCGCAGTCCGAATCCAAGTCTGAGATGGCTTAGCTTCGGGCTGAAAGGAG
CTCAACGTGTTTTGGATGCAGTCGCAGGATGTCTGTCAGCTGGGCCAAAA
GGGTTACCCTAATCCTAGTGCCGCGTTCCTAACCGAACTAGTTCCTCTGA
CTAAGCGCTAAAGTTATGCAAGTCATACAAGAAAGTTGGCATTTTAATTG
TGTTAAATGCCTTAATTTATTAACGCAATAACTATGGGATTCGAGAATTA
GCAACCAATCAATAAAGTCAATGAGGGAAAACATCACATACTCGGACTCG
GTTTTTGTGTTGTCTGTGAACCGGTTGCCACGCATCCTTGGCTGCTGTGC
TGGCCTGTTAGTCACGTAGCTTAAATGAAGTCCCAGGAGGATTGAGGGAC
GGGAACGGGAGGCGTTCGCTCACGTTCATGTCGGTTGGCAGGCGGCATTA
TAATGCATTTTCTGCTTTTTTTTTTTTTTTTTGCAGCCCGTCTCTCCGGC
TTTGGCTGGCACTCATTATGCGTTCGTCTTGAACTCCGCACTACTCCGGA
CTCGGGACTCCGGACTGACAGGTCCTGAATAGGCAACAGGCAGAAGGTCT
CGTGCGATTTTTCCTTGGCCGCACATGCCTGACTGCACTTCAATCAAAAT
CAAATATTACACCCGGCAAAAGGGGAAGGCAGGTGCCAGCGCATACACTG
TAAAAAATGTACATATTAACAAAAACATTTGGTTTTTAATTGGCTTTAAA
ATATATAATTTTTTTTGTAACTTCGAGTTTTTTAATTTTATACCGCTACA
CTATGGGGCATTTGGCCTGTTTTTTTTACAAAAATTAATACCTCCTAAAC
TATTGGAGATATTTGGATGAATTTTTTTTTATGCGTTACACATGCCTCCA
GGAATATTTTGGAAAAGTGGGCGTGCCCCAACTCCGCCCCAATTTTTTTT
TTTTTTTTTTTTTTTAACAATATATTTTTAAAGCTTATTTTTAATTTCAA
TATTGTATAATTCATAACCGTCTTCCTCTTCACAATCAGTAGAGTCTGAA
GAATTTTTATCAGCTTCAAATTCGCAAGCTAACATTTCAATGACTTCTGG
TGGAAGAGATAGTCGCTTATGTTTTCGCCTCTTTAAATTTATTGATGATA
TTATGGGATCCGAAGTATCCATTGTTCTGTAAAAGACATTTGCGAAGCTA
CTAATAGTTTTTGCCGTGGCTGGGTTCAACAAAAGAATTTTAAGTATGGC
TGCAAGATCCCGCAGGTAGCACTTCCGTGCAGCTTGAACCAAAATACGTT
CGTTGTGATTCTGCGCCCTTACGAGTTCATCTGCTTGCTGTCTTCGGCCA
CTCAAATTTTTTAAATAATATGACGTTTTCGGGAGTCCAACTAATTTCCT
TTCCTATTTATTTTTCTCCTTTACCTTCAGGACTAGGTGTTCTTCTAACC
AATTTGAAAAAAATTTTAAAAATTCATTTATTTTTCGATTGCATTTTCTC
CAATTTCGCAAAAGATTGACTGAAATCATTCGTTATTATTATTATTAGTT
AATCGTTTATTAAAGTCTAGCTTGCTATCAGAAAAATGCCCACTGATAAA
AGTGCAAATAGAATTTTCCTTTTGACGAACACCCTTTTGCGTGCGCCACA
CTTCCAGCAGGGCAGCATTGGAAATCGAGATATTGCTCCCTAAAAAATGA
AATTTCTCAAAAAACCGCAAAAAACGCACATAGAGACTACCTGATATGAG
TTAGGAATTGAACACACTACAACATGGATATAAACACATACTGAACAAAT
TTGAACAAATTGTTGTAGCTCTATTCAAAGTTGAAAAATTTTTCAAACAA
CTACATGTTAACACCACTTGCTAAATGTACAAATTGTTAGTAGTAGACGC
ACACAATAAACAATATATTAACAGAAACACATAATACAAACCTGTAGATT
GATTATCCATTTCAAATTTTATTCTTTTGCGATCTTCTTTTTAAGTTCTA
ACACTTTGAAAGTTAAGCTAAATTTTGCGCTCAATGCAGCCACGTGGTAT
GTGCTCGCAACAGCTGACTTTAACAGCTGTTATTATAATGATGCGCTGTT
AAATTAACTTTTTCGGGCTGTAACATAACAGTTTAAAGTATTTCCAATAT
ACTAATACTAAAATACAGCAAATTTGCATACTTGTGAAAAACACATTTTT
GTAAAAAAAACAGGCCAAATGCCCCATAGCGCGCTAGGCTGCAGCTAGCT
GGCCTTGCCCCAAAAAGTATGCTATGCAAATAGTTTCGATAACGTATACG
ACTCGTTGACGTGCTTGCGCGATTTTCCAATGGCAATGAATGGATTTGTT
TCTCAGTGCCACATATGTGCACCGGCTTTCGCCTTTGTTGTGTGCCTCAG
ACATGCAGACAGATATAGCTGGCCATGGCTTGATTACGCACGTTTATTAC
TGGAAAAGCAGCAGGAATTGGAAACAGGATCGGAGAAAAGGATTCACAAA
TGGGCGTTGGGCGCGGGGCTTTGGGCTTTGCCATCAATATGCGTTGTGTG
GCCTGCAAATGCACAACATGATTACTTGCAAATCACCTGAATGCGATGCG
GATTATGAATGGCAATGTGTGGAGGGAAGCTGTGGAGATGTGGAGCAACA
AGTGCTGGAATTATTTATTTCTAATTTAAATTTTAAGCGGTCGCGCCGCT
GGCTCATGAATATTAATTTCGATTTTAAGGCCGCAAAACAGTGCAAACTA
AACAAGAATTACAACTAAATATTTATAACTCATTTTCAGCGCGATGCGCA
TACACAAAGATAAATAATAGACAAAGTTAAATAAAATGGATTTACCAAAA
GTGAGTGAGTGTGTGTGTGTGTGTGTGCGTGTCGAGCGTGAGAATACACA
AAAATTAACTTGTATTTAAAATTTAATTAAAACTTTTGCTGTTATTTACA
TGTGCGGCCTTACTCCGCCCATCGCTTTTTATAAAATGCTAAAACTTTCG
CTGGAAGGCGTGGCACTGCGTACTGCAAATGCAGCTAAAATGTGGCCAAA
ATCATAATGCATTACATATGCATGGCCATCGGCATGCCAATTTAATTGAA
ATATCGTGCACTATTTTTGGTTTATCGCATCACGAAGAAAAATTAAAATA
CAGAACATCGAGTAACAACTGCAGCGGCGGAAAAAAAAGAAGCGAACGGA
TTTTGGCCATGGCTAACTGGTTGTTGCGGCTTTCGCGTTTAGCATAATTA
GTCTTTCTGACCGCATTACGTAAAATGCGGTTGATGCCTCTCAATGCAAC
GTTTCCCTCTATTTGGCCCAAGGCCGCTGCATCCGCACAAACAATGCCAA
AAATGGAGGGCAGTAAAAAAGCATTGCTTTCGACCGTTTAATATGGCTAT
CAGGAAAATATCATATCATATCGATTAAGTACTTTTGGCTTCTAATTCCA
ATTTTCCACATAAATTTAATGAATCTATATGTAGAAGCGATATGCTGAGA
TGTAACTGATCGCTGGTAACGTTCTGCATCTTTTGTTTGCTTGGTTTATA
GTCTAATGCAGGTGTTCCCTGATTTCAGCCAAAAAGTATCAATTTTTTGG
CCAAAACTTCGAAAATAATGGTCCAAATGTGGAATGTCATGGCTCATTGA
ACTCGTAACGAAATTTCAAATCGAATAGTGCCGAAAATTGGAAAATCGAA
TTTTTACCCATTTTTCGCAAATTTTGATGATGTTACCCCTTATAGAAAAT
CAAAAAATGTCAAAAAATTTTAATTTCCTTAATTCTTCCAAAAATGCTAC
AGAACGTTAGTACTGCTTGCTAGCTTTAAAAAACAGTCGGTCATATGGAT
TTTTGTCTTATTTTGGCCAAGTTACAGCCGAAAAACTGAACAACAGAACC
ATATTTTCATAAATAGAGAGATTTTCACCTTAGAAATGTGTATATTTTCT
GCTTATTTTTCTGTGATAAAAATCTCTTGCTGATGCCACTGTATTCGAAA
CGCATTACTCAACTGGCTAGTAATTTGCAGCGTTAAATGAACGGAAATCA
GTAAACCCGCCACCGATTGCTTGAATTAATTCCCCTTTAAATCGAGTGAC
CACTGTGCTTCCATTCGTAAGGGGCGCTAATGAACAGTCGTTATATGTAT
GTATGAGTATGAGTATGAGTATAGAAGGCACCAGCCACCGACTTTTTGGG
GCGCCACAAAATCGCACTCGTAATGCGTTTGGGCAACTTCGGGCCACTCG
ACTGACCAAACAATCCAGAGAGTGGCGCTCGCTCTTGCAATTTATGGTAA
ATTAATTTGTAATTAATTTTTATACGAAACGAAACGAATGAATTTGTATG
GGCCATAGTGCCATATGGCCGCAAGCAGCAATTCTATTTGTGTTTTTATT
TCTATTTTACGCTAGTTTAGTTTCAATTGCGTCCAATTAAACATGCGGCC
ATCGCCCAACCGCCGCTAAAATCCGCCATTTCCGATTGCCTGGTAACATC
CAACATCAAATTTTACATCCCAATCCCAATCGCTGCCGGTTTTCCGCTTT
GCCCCCTCTCTACACCACCAGCCGGGGCACATTGCCATTTCCATCCAGTG
AAATCCTGAGCTGTGAATCCTCTGCGTGTTGCACGCGTTTTGTGTTTTTC
GGAAATTGAAATTGCATATTTAAACAGGCCATTCCCACTGTGTCCATCGC
ACTAACTGTACGTGTATGTGGGTTTGTTTTGAGTGAGTGTGTGGGATGTG
TGTGCATAGATGTGTGCGTGTCGTCATTGTGGCAGCAAACGGAAATAAAG
TGTGTTTCTTGTTGCTATACCATTTCTAAGCACTTGACTGCGTTACGCAT
TCGCTTCTATAATTATTATTGTCCTGCTGCCCAAGGACATTCCAATTGGA
ATTACACTTGTAGAGGAATAATTTAAATTATATTTGGAAAATGTATTGTA
TAATAATTATTTGAGTTCATTTATTTAACTCAAATATTTTGTTGTTTTAA
ATATTTCGAATGAGGTTTCAATTTGAATAGCATAATAATTAGATCCATAG
CTTGGACATTTATCTTTCAGTACAGCTTTGGTTGAACCTACGTCAATGAT
TTCGAAGTACCTTTTGAAATTCCCTGAGGAAATTCTCAAGAATTAATCAG
TGGCTAAGATGTTTGACCTATGAGGTGGCTGCCAGCGGCAAAATGGCTCT
CCAGCTCAAATTTGATATCTGATGATGATTTAAAATTCCATTTATATCTC
GGGTTCCGGATATTGGTGTGACTGACAACTGAAGAGATTACCCATCCGAA
ACAAATCAACAACAAGCGGTAGTTTTGGTTTTCATATAATACTTTCGCTT
TTCATTTATTAGTTTTGCATTCTTCAATTTCGTTTTCTCGGGAAACAATA
CCTTATTCGTTCACTGCTGCTAACCCGTTCTATGCTTAGTAATTCTTGCA
TTTATAGTTACATAGTTACATTTTCATATGGCAACACAATAGTAACTTAC
AGTCGTAGCAAAGTGTTACCGAGTTGAGGAATTCGAAATTCGAAATTCGG
AATTCGTTTCGATCCCCATAGCTTTTATACAAATAGTTAATGCTCTACAC
ATAATCGGGGGGCCATTTAGTATGTTCCTTAGTTAGTTGGTTGGTTGGTT
GGCCCAAAGAAATAATTGCACAAAGTGTCGCTCGACAGCTGCGAATGTGG
GAATTGAACGGATCTGATATATATATGTGTGTGTATATATATATATATAT
GTATGTTTAGGTATACTATATATTCGTGTATATTATACAAACTCAGTTGG
TGCTAATTGCTAAATGCTATTCAGTAACTTAGGTTCTACATTAGCCATAA
TACTTGTCTTTACAGCACTTTACAACACTGTTCGTCTTCAAAAAAAAATG
TCATTTACTTTATTTAAATATATATATATATATATAGATCGTTTCTGGTT
TACTCATTAATTCGAATTTGATTTTCTTGGGCTTTTGTTAGCAACACGGC
TAGTTAATCAATTAATTAGTTAATTCTAATGCTTGCCTTCTAGAGCTAAA
TTACGTAATATAGCCCATTCAGTTTAGCTAGTTGTATACTCCATGACTGG
TGACTAGATTTATAGATATATAGATGGCCGCTAACTGAGGATGGGATGTC
CTGCCGGATTATAAATTTCGAAGCCAAGTATATAGACGCTTATAGATGCT
TTGGTTGTTTGTGTTGAGTACCTAAGGGTGTGGGAGTTATATATAGCCAA
CCTATATAGCGTACCGATTTTTGTTCAACTTCCTGGCTGCATTGCTTAGT
AGTTCGTATTGGTTTTATTTTAGTTACTGCACTGTCTCGATCGTTCGTAC
ATATATAGTGGTGTATATATAAACAGAGGTGTCACAGAAATCGCAGCACG
ATTTGCATATTTTTTTAAAACGTTTTCGAAAGCATCAGATTCATTTATTT
GGAAAGAAAGAAATGTCTTGAAATTTTCAATCCTGTGCGATTTCTGTAGA
TCCCCTGGTTGAGTGTGGTATATATGTGTGTATATATATGAATTTATATA
GATACCTTTATTTTTGTGTATATTTATATGAATATTTACTTTTTGTTAAT
TTCTGTTGCCATTTGTTTATATTTCGTCTCTAACTCTTCATTAATCTTTC
GTTTCATTTTTGTTTGTTAGTTATTGTCCACCCATCCAGTTTACGGAAAT
TCTCTTATTTCACTTTGTAGTCGCATTTTTTTTTGTTGCTCTTAACATTT
TTTATTTATTTTTTGCTAAATTGTTTTTGGTATATCGGCATATAACAGAG
GAGGCGAATCATAAATGATTATGAATTTATATGTATACCTATATGGGATG
CATTGAATCGGAAATATTTAAATGAGCCGCCCAGATTAAATCTAAGCTTT
TAAATCGACCAGATTTTCTGTTCGACAAGAACATCTATTCAAAAATAGAT
GATTGAAAAGCAAGAGTCCTTGTTTATTAAATTAACACACCCATAAATTT
ACAAAATTTAAGCTTTGCATAAAAAAAAAAAAACGATGATAGACTCGTGC
TTTTTGCGCTTTGCATAAATACATATAGATTGAAGACAAAAACCGAATTG
TATTAAATTTCATTGAATTAAGTTCTCATACTCCGCCACAAGAATATGCA
ATAACATTTTTACGGAAATTTTCAGCTACTATTTGCTATTTTTCGCTAGT
GTCGGTGTGCCAGCTTTTTGTTTGTTAAATTTAGCATTTGCGTTTGGCAT
GGCATTTACTCTATTGTTATACTCGCTGTATAAGCATTCCTTTTCCGTGT
TTTTTTTGTTTTGTTTTTTTTTTTTTGTATCCTGCCTTTGTTACCTAAAT
TTGTCCTGCTCTCGTATTATTAATAATAATGAAATAAATAATACAATTTG
CTGTGTTGCTGCTGCCGTAGGAATATTGCAATTGCAAGCCAAACGAATCC
TGAGTTCGTGTTGTAAACATGAATATAAAAATTGAATGCGACATAAAAAA
TGCAAAATGCTTCGTTGCCAGCCTCAGTTGTTGATGTTTTTGTAACCAGT
TGTTGTCATTATAGTTGTAATTGCTGTAACATTATTTACCACACATAATA
ATAATAATAATAGCAATAATAATAATTGCTTTTCGCGGCACTCGTAGCCC
AGTTGTCAACGTATCAAAAGTCCCGTGTCGGGTGACCATCGATTCGCCCT
ATAGTACATATCCTTGTACATCGAGGGGCACGCATATTGATTCTGTTAAT
ATTGTAGAAAAGTGGGTAAAGAAATTTAGAATTTAATATTTTAGGCAGAT
ATATATACTTGTTGTTAGTGTGCTAAAAACACACGGTTGCAGGACTCAAA
ACTAAAAAATGTAGAGATATAAATATTGTTCGAAATCGTTACAATGTTTA
ACACTTTACGCATGTGCCCACAAAATTGCCACCCCCTTTGCATTAAAAAT
AAATTAACAGAAATTATACTGCCATGTTAATGCTATGAAAAAGTAATCAG
CGATAAAAGTTGCGCCCACACGACTACCCCAACCCCAACCCCATTAAAAA
TAAATGAACAAAAAATGTGTAAATACTATAATGATGTGACCACAAATAAA
AACCGTGTCCACTTTGGCAACCGTGTGGCGGCTAATGGGTTAATTAAAGC
GATGCCACTCACCTTGTTTCGCTTAAAATCTATGTTCGTTCTTACGGTTC
TATGGTGTAAACTTTGCACTGGTCGCGCATTATTACCTAGTGGAGCTTTG
GGTGTACTCTCGGAGCCTTGCATCAGTCGTCGGAGTTGGTACAACTGGAA
TATATATGAAATATAGCATAGCACTGGTGTTATCAATTATCGATAATTGC
TTAATATTTGGGCCCTTAGGCGGGTGGTTTGCCTAACTGGATAAATTAGC
CACTAATTGCTGCCAAATTGAGTGGTAAATTCGCTGTGCAATGTGTCAAG
TGTTCAATTGATATGACTGGCATATTGCCGATCAAATATCATTTAATAAA
TTTATTATGCAAAGCGCTACTAGTCAAAAAGCATCTAGAGAAATTATTCT
TTTAATTCTATTTTCCTGGTTTTTTTTTTCTTAATAAGATTCCCACAAGT
ATCGTGCAGTTCCGAAAAGGCCTGTGAAAATCACAATTGTCATTCGCTGA
CTTGTTTACATTCCACTTAATGCATTTTGGGGCTTTTTGCCTGTCCTATT
TATTGTTTACTCATTTACTTTGAGTATTTTTTATTTCTGCCAACACTTTT
GACCCCAGCGGCATGGCCATTACACATGTTTCATATGCATTTATGCAAAT
TGATTAAACTAACCAAATATTGTTTTTTAATTATGCACAGAGCGGAATAT
TGACCGCATTCCCACCGCGATCTGACCAATGCCCAAATTGATGAGCAATT
TTATAATTGCATTTATGCGATTTCATTGTACTTCCAATCAGCGACCAGTA
AAAAAGGAGTGAGTACTACAGTATGCAAAAAAAAAAAAAAAAGAAGATAA
AATAAAAACAACAAAAAATAGGGAAAAACGAATGGCATCGAATCGAATCG
AATCGAACATAAATAAACCAGCAAGTACAAGCCGCTCTAATTGCAATTGA
AAAACACACGAAATGCATTTAATTATTTGCGGTCCGCAAATGGAGGGACC
ACAAACTCACCTCCTGTTTGGTGATATAGATGGGCTTATTAACTATGATC
CAGACGGTGCTCTCCCAGCAGCCCGGATGCGTCGTGGAGCCCTCATAGGT
GATGTAGTGATCCGTGTTCGGCAGCAGCGACCTCACGGATATGTGTCGGA
TGGGCGTGGAGAATCCTGCAAGTGTGGAAGGTGGCACAACAAGTTAGAGG
GCTAAGTTCAAGGTGGGTGGCCCCGGCTATTTATGCGCATATCGCACAAA
AAAAAAAAAAAAAAAAAAAAATGTAGTATGAAAACACGTCTGCCGGGCGT
CTAATGAATTATTCAGGCCAGTTCTTAGTTCCCACTTTTCAGTTCGCAGT
TCCCCGTTCCCGGTGGCCAACCTGACCACTTCAACGTCAGCGCTCGGCTT
TATTCATACAAATCATTTTGCCAGCCGGAAATGAAGCAACTCGCGGCTTG
CAGCCCAAGTCGAATGAAATCCGCGGAAGGAGACGGTGTTTTCTGCGTCC
CAACGAGTGGGAGTTCCACTTTTGGGCTGAGTTTTTGCATTGCGGTTGTA
GCTATACTCTGACATCAATCAGCTGATTGAGAGGAGTATCTCACGGATAT
GTATGTTGGCCAGATAAACAAAATTGCGTATGTCTAAAGTATTTTCTAAG
CAAATAATCATTACCTTATGGTATGAAAATAGTACTACAATATTGATAAT
CTATCAACCTCTTTAACTAACTTTTCCCAATATTTTCGTTAGAGTATCTG
CATTTTAAGTACTTTAAACTTTACATAGCCGCCTTATCCTGCAGTTATTA
CGGTTCTTCTTGCTTTTGTTGGCGAGTGGCCTGGCATATTTCTTGGTTCT
CGGCTTCATTCGGTCGGTTTCGCCCGGGCATTTTACAAATTAAGGCTGGG
GCTGGGCCACCATAAAGTTGTACGACCTGTAAAAAGGCTATTAAACTGGC
CAAGAAAATGCCAACGAGACGTGCAATGGGTTTTCTGGAAGGGGGTGGGG
TGGGGTGGGGGGGGAATTATTAAGTGTCGGTTTAGTGTAATTCGAGGTTT
CATTTTCGTCACTTTGTGCCGGCCAGTCTCAATTTGGCACGCCCCATCTC
AGCCACCTCTGACCCTTCGATTTTTTTTTTTTATGGTTCGCCTGGACATA
ATTATGGCCCACCGATATAATGTTGTTGTTGTTGCTGCTGCTGCTGCTGC
AATGACATCATAAAAAGCGGGCAGCCAAAGAAAAGGCAACTTGCAACGGT
ATTAACATTGCAACATTTCCGGTAGCATTTTGCGTAGACGGAAATGATGG
TGGTCGGTCAGCGGTTTGGGGATTGACGATTCTCGTTGCTGCCAGCTACC
AGCGGGCTGGAAATTTGCACTCACCTCTATACAACACCTTGTTGAAGGTG
CTCGTGATGATCCGTAGCTCCGGATTGGGCGTCTCGCCAATTTGCACCAT
CAACGAGAGTCCAACGATTCCCTGCGACTTGTGCTGCGCCTCGGACATGT
TGTGGTACAGCTCCTTGTTGAATCCATAGATTTGGATCTACAACAACAAT
TGATTACAAAAAAAATGGCAAATATGTAAAAATAGATTTTTTTGTATAAC
ATTTGAATATGTCCTTGCAGAACTAACCTCGCCGGGAAAGCTATAGCCCT
GGATGAAGTGCTCGGATCCGCGAACATTCTCCGTGCCATAATGTATGTAG
ATCTCCTCGAACTGGTAGCGGTAGGCCAACGGTCCACCGGATATGTTCAC
GTGCTGCTTGGTGTCCTTGTCCACGCGGAAGACCAGCGACTGGCCCGTGT
TGTGCAGAGTGCCGGAAACCTGCAATGCAAATGGGATATCCAGGACATCC
GGGTCAAGTTAAGGGTCTCGCCAGGGGGGGGGGGGGTGGAAGTAGGTGGT
GGAACACCTCATGACCTCGTGGCCTCTACGCACCTTGTGCTTGTCAATGT
GCAGGGGCCGCAAATATGGATCGAAGAGCAACTTGTCGGGCACCACGTCG
ATGGGCGATTGGCGGCGTCCTTTGTTGCACATATTCCACTGCGGATTGAT
GAGGCCCCAGAAGCTTGGTCCTGGCAAAAAAAAAAAAAAATGGATGAAAA
ACGGATGAGTCGTCGCCACTCGAACGGATACACAGAAAGATACACAAAAG
TTGTGAGTGGGATTTTTGGCTTTAATACTATAAATCGAAGAATTTAAGCT
AACAGGGGTAGCATATATATACATAAGTTATTAAGGTAACTCTTATATTT
TAGTTACCAGATATGTGGCCCATAATCAGAGAGTCTAAAAAGTGTTTTCT
ACCGTACAAACATGGCTATATACATCGGTTATTGGCCTTCGTATCTGTTC
ATGTTCCTCTGCCATATATAGTGTTCTGTCAATCGAGCAAATGGAAAACG
TGTCTTCGCCTCTTCGCCCAATGCAAACAGAAACAGAAACAGAAACAGAA
ACTGCAGCAGCAACATCGATGACAATTTCAAATGCCAAATGAAATTTCAT
AAGCTCACCAACTGGCCCCATCGACCCCCTTTTAAATGGCAATTAAATGC
AATGCACCGATGGGGGTCAGTTGCACCCTCACATGTTTCGGTTTGAGTTT
TGGGTTTTTGGTCGCTTTCCAACTCCGATGTGACGGGCTGAAAACTGTCG
AAAGTTTTCAAAACAATGCTTCACCAAATAAGTGTGTGTATGTGTGTGTG
TATATTGGCTATCTGAGTAGGGTGTGTGTGGTCAAAAGGGGGCGGTGCTG
TGGTCCCTGGTAAAAAAAAAAGTAGTGGCAAGTGGCTTTAGGTCTATGTG
CCTCATGCTAAATTTAATATTTTTCTCTCCATGTAAATACTAGGTGCCGT
ACGCTTTTTACTGCGGTTTTTAGAACAAATATTAGATACACTTTACAAAT
TATTATTGTAAGACTTTTGCCTCATTGAGTTTTGAAAATTATAGATGCAC
TTGATTTCCTATGCAAATTAAACACGTTTTTTGAATATTTAATTATCCGA
AATTGTTCAGCTTTATTGATGAATCGCAAAATGTTTTTCAGAATTTTTGC
GATTCGAATCCCGTTTTCTACACTTTGGTATCGATGGCCAACTGTTGTGT
GTGAGCTGTATGGTTGTTTGCCATTGTATTTGTGTGGGTGCATTGATGCC
ACGCGGCGGCAATAAATGCCAAAGTTTAAAAACTGCTCCGTGGTGATGCA
GCTGACCCGCCCATTGTATTGTGACCCACTCCGCCCACCATCGCCCCCTT
GCCACCCGGCAATTGTCGCTTTTGTGGCGGCTGTTCATTTTGTGTTTTGC
ATTCATTTGTTGCTATTGCTACTGTTGCAGTTGCATGTTGCTTGTTTCTC
CTTCCCCTTCTTCTTTTTTTTTTTTTTTGCTTTCGTTTCCTATTTTGTTG
CTAAAAATGCATCAGGGGATGAAGGGGAAGGGGAAAATGCAGACAGTGAC
AAGCAACAATTACAAGAGCAACAACATCCCACACCCACATTGTTTGTTTG
TCTGTGTACTCTGTCTGCGTTTTTGTTGCCAAACCATTTGAAATGTAATT
AAATCAGCCGCAGCATCCGGCTGGGGGTGCAAAAGTTTTACCAATTTATT
CATATGAAGATTCAAACATTTGGCAAACATTCACAAAAGTAATTGATTAA
AGGGCGGTAAAAAGGTGGGGCTTTGTTGAATATTTGTAAACTGTTGGTGT
TAAGTCAAGGGTAAATAGTTGATTTCATATTTGTTAAATTAGTTCAACGT
TTTACAGCTTAAAACAAATTTTGTAGCACTTACCGGATATGCCATCGTAT
GTCCACCACTCTTCCCAACTAGACAGGACCTCTGAAAGTAAGAGAGAGAG
AGAGTGAGCAAAAATACCAATCAAATCGAGAGGCTTAAAGCTGAAAGGTA
AGCACCAAGGTGCCAAGGAGCTTAAAGTCTAGACAAGTTGAAAATGCCGG
TCGAATTCCACTCCAAGGAGCAGTTAGCCCAGCCCGGGATACCGAATCCC
AGATCTCCGAATCCCTTTGCATATGCAGGAGCGCAGGAGTGCAGAAGTGC
TGGGATTGGGATGCGGAATACCCACACCACCCGCTGGCAGCAAAATCTCG
GTTTTTCAATGCGCATAATTCGCTGCCAATGTAAACAGCGCATGAAATCA
ACTAATGTAAGACTTCCTCGATTTCGACCCCCTCCGCCACCGTTATTTCA
CCCGCAGACTGAAAGTCACCGGCGAAGTCAGACAAAACAAACAAGCGGCT
GCTTCTTTCTGGGGGGTAAGCGATGACTTTAGTTGCCAGCCATCGAGACG
CCATCGGATCTCGTAGTGGTAGTGGTCGTGGTCGTCGTCCTGCTCCTGGT
CTTCTGCTTATCCTGCGTGTCGCATGAGTCAACGTCCAACTGGGCCACAC
ACAAAAAAGCAGCCGGGATGCCAGGATGCTGGTTTACTGGATTCGGGGTT
AAGGGATGAGCATGACAACAGCGATGTCGCCAGGCAGTCTGGCGCCAATA
AAGTTTACACTCAGTTGCCACATTTCGTTTATGGGCAAGTTCTGCTTCCG
CTTTATCAAGCGACAGACAATTTTCGCTATTTTCTATTTTTTTTTCTTCT
CATTTTTAGCCAAGACCCCCTTTGACCCCCACTCCCCACCCTTTCCCCTT
TGAGCAGTTTGAGCGTATTCAAAATTTATGCTATATGCGTCGTAACGGAG
CTTTTTGGCAGGAGGATTCTGCACAGGGTGAAGGGTTGGAGCGTGGTGGG
AAGGTGGGCGGGTGTTTGGGCGGCAATAAAGCCCAAAGAAATTGCTGCAA
GCCAAAGCGGAAGTTCAAAAGGGAGTCGCTGGAACTGGAACCGTTGCCCG
CTTCCTGTTCGCTGCCATCAGTGCGAATACCCTGGGGCCATCAGTGGAGC
TACTCCGACTTTGGGGCGAAGGAAGTGCACTTATCGTGACTTCCCAGGGT
CATCATAATTCTACCTCAATTGGTCTTTCCCATCAGGACTGTCGTTTTTA
TATTGATATAATTTAATAGTGCATTTAATGAGCTGTCTTAAGATCTAACA
TTTGCAAGTCTTATGTCAATTATAAACAATTATAATTATATTTAAGATTT
TCAACAGTAAATTGAATTAAAGATTTGTTCCTTGAATGTGCTAATAAAAA
CTAAGAAGCAGTCAGTTTTTTTAATGACTCCAATAATGGTGAGTGCTCCG
CAACTACGATAGATAGTGTATCCCCAATTTGCCAGTTGATCCTTGGGCAT
CTCGTGCCTTTGTCTCTGTTTGCTTCTGCTGAATTCCTTTTCGGGTCCGT
CGTGTTGCTTTTCTTGGCATAACAATGAACGTCCGTTTTTTGTGAGCCGC
GACTCGGCGACGTCACTTCATTTTGTTCATTTGTTTGTTTATTTGTTTGT
TTGCTTGTCGCTTGCCGGCGATTCTTTTTTGCCTCATATTTGCCCGGTTG
TTATTGTCTGCTTAGCGCTGTAAAGTATGCTATTGAATTGGCCCAAAAAA
ATGGAAGAGCGATAAATGCTTGCAAATAGCATTGAGGAGACCCCGGCGCA
CTTTGCAGACCAAAGGCTCTGCGATTCACTTCCAGGACTTCACTCACTTC
CTGCGATTCGTCAACCAAATCATCCAGTCCACCCTCAAATACAATTCAGT
CATTTGGTAAATTCGTTTTTATGCTGCAACAGCAACTTAATTTATTGCTA
TAACAGTTTTATTTCATCGCACCCGAAAATTCGTATGCACGGCAAAAATT
TGCATGCCAATTATAGAACTGATTTTTATTTTGAAGCGAATTTGAATTTT
TGTAAACAAAAAAAAAATGAAAAGAAACTTTCTGTCTCCAAATCGGCTAA
TAAATGTGAAATATTCGAGGTTTCAGTAAATAGCTTGAGTTCTTTTTTTT
TATGTGATATAAGTGTGTTGGATTTTCTTGGTTTAGTGAGGGGAGAGGAT
GCCAAAGACAGCCAGTCTGTCGCCACAATTTTGTGTGTATTTGCGAGTGT
GTGCGCTTTGGCCAATGGTTTATGGGTTCCTGTTGTTGGCCATTCAAATG
GAATCTGGCTTTCGGGTTATTGTCTCAATCGACCCCCGGCCCCCTTCAAA
ACCCTCCACCATATATATATGTAGATGTACAATACCTCCATCTCTATCTG
CCTATATTTATAACTATCTATTTGGCCTCACTGGCATTCGGAGCATTACG
CCTTTGTGCCAGTTCCAGCTGCTTTAATTCGTATCTAAGGCTGTTTATCA
ATACCAGCGGCCAGAAGTCGAAACACGTATATATGTTTATGGCCATAGTT
GGGCGTATAAATAGTTCATGGGTTTGCCGATTAGATGTCTGGCCCGGACT
AAATTCAATGTGTTCAATTGGGTTTGGATGACAGTTTTATTTAATGAGTC
CTTGGCAGTTCACTTACTCAATTTATCCCGTTCTATATGTACCAATTATT
TAAAATATATTTAAGCTAGAGCACTAGAAACATGTTATCATTGTTAAATT
TTCGTTCGTTTCAATAAATCTTCTGTTGTCTAAGAAGACCATTAGAATGT
CTACAACTATCATGAATATTTAAGTATAATTTCCACTTCATTCTTCCTTT
CAAACTGCATGTTATTTGTCATTTCCGTGTGCTTAAACCCTATCCACAGT
TTATTACTTTATCACAGAATGGACTTATTAATTGCCGTGTTTGTGCTTTT
ACCCACACGAAGGAGCGTGAGTCACTTGCTTATCAATAACAAGCGCGTTT
AGATGACTAAATTAACTGCGATTTCCATTTGGCTTGTTTATTTGTTTGTT
GTAATCAGTATACGATATGGGCGTCAAATCGGGAATCAAAATCAGAATCC
GAATCGGAATCAAGTGGGCGAAATGAAAAGGGTCGGGTCGTGTGCCTGGG
CCATTTAGCCATTGTTATTTGTTTGTTTGCTTGCTTGTGTTTGGCGTGTG
CGTGAAAATGGCGTAAAGATGGAATGTTTGGCTATCAAAAAGCAGGAAAA
TGTCCTCGACTTTCGCCGCAGTTCCCGTTGCGGTCTTCAAATATAGTCAC
GCACAGCATATCGTGCGTGGGTGCCATCAAATGAGGTCCAAACACGCCCC
ACTTTCACATTTCAATGTCTAAATGAATTAGACAAGCCAAACAAAGGCTG
CTCAAGGCAAACGATCGCGGGTGTATAGCCATAGCCCTTTTATGTGTAAA
TTATGGGTTCAATATAATATTGACAGTGAATCAATAAAAGGAAATGTCCT
TAAAATTAATAGGCGACATTTTGATATTGAATTACTCGCTGTGTCATCGC
TTTTAATTAAAATTTCTAGACAAGGGCGCGGAATGCACACAAACTTACAC
ACCATATATATATATACATGAATGTGTGTGTGTGTGTGCATTTATCCCGG
CATGTCCTGGCAGAATTTATTGCTTCCTGTTAAGCGGGCAGAGAAGCGCT
GATTAGTATCTGAAGCGCTGCTTCAGTTTATCAAACTGTCGCCTTGGCAG
CCCCCTCAAAAGATTGACGACCACAACTCCATAGCCCCCGAACTTCCCAC
ATGAGGTGTTTCCTATTTTTCCACCCTTCACTCCCCTCCCTTTCCCAAAG
TCGTTGCAAGTTAATTTACTCGCAAACATTCGATCAGATTTCCTCGTCTC
TCGTTTTCTGCATTTTTCGCTTAAATATTTAATTTGTTTCCCGCACTCGA
GCTGAAAGCTCACACTGAATTTCGATGGAAAGCGCATTAATACTGATTAG
CTGCATAATTCATTTTCCGAAACAGGGAAAAATAGTTCAACTAAAGGTAG
CGGAGAGCAGACGGCAGCTTTAAATATATTATTAACTGAATTCAGCGAAT
GCTAAACTACTATACATTTTCAATGTTTTTGAAAATGCTCTCCAAATAGT
TGAACTATTGAGCTTTCCACATGCTCATCACTCTCAATTGGTGAAATGCA
TATTGAATAGTTTTTGAACATTTAATGATGTACCGAAATGATGTACCACG
TTGAAACTAAATTAATGTTAAACACAGAATTTTCCCCAGTGAATTCGACT
AAATAATTACGCATTATTTAGGGGAGTTTGAAAACTTGCTGTTAAACTCC
CTGGACTGCCATTCAATACACAATTTACATCTAATCGCTTAGCAAATTAA
CCAGCAATAGGGAGAGAAACAATTTCCACGCCATTACATGATTTTTCTAA
ATAGTTGGCAAAAGTTTTTCCATTCCCTCAATCCAGAAGGAAACATTGTA
AGAATTCCCCACTTTATTTCTTCTTCTTTTTTTTTATTATTCGAATTTTC
ATTTTGTGTTCTTGCAGTGAAATACTTTTGTTGGTTCTTGGCGCCAAAAA
ATAAAATTCCCATTTCATCTTCGGGGGTAAATTAAAAAATGGGTCAGGAA
AAACCAAAAAAAAAAGCGAGGAGGAAAAATCGAGGGGAATGCTGATGAAC
AAAGTGGAGGGAAATAAACGTTCAACTCACGCGATGAGTTAACAGCAAAA
GTTGATGTTTGTGCTGTTTGATTTGTTATTTTTTCGCATGCTGTGCAAAT
GCGTTTAAATGCTCCCGAAAACGTTGATTGAAAAGCAATTTCACCCGGAT
AAGGATCAGCTTCGAAAAAAGTCATTAAATAAAGTATAACCGCAATGGGA
GCCGCGCTAAAAAATGTTTACGAGTCTTTTAGTTATGTTTTTTTTCATTT
CTTGGAATTATTTATATTATTACATTATTTATAGTTTTAATTCTCTTGTA
TTGTATGTCATGGAATATCATGGAACTTTTAGCCTAATATAGTTTATTAA
GTACTAATGTTTTTTCCCAAGTGCATGGAGGTAATTGCTAACAAAGTAAG
CCAAAGCTCATGTTCAGAAAGGATCGGGGACGGAGTCACAGGGCGAGCAA
ATACAACGCTTGAAAACCATAATTTGGCTAAAAACCGTCTAGACATTTGC
CGCTTGCAACTAACCAACTATCTTAATTTGTTGGTGCCAACAAACTTTTA
CACACCAACTCCTTACTCATTTCTCCCCCTAAAAAAAGAAAAACCACCTG
GCAGAAGTGGCTGAAAGAAAGCGACGAAGAAGGCTCAAGAGGAAGTTGTG
GCCGCTGCTGCTTGGCATATACAATTTCGATAATAAGCAACAGTACATTT
TCCTGTGCACCATGGAAAAGTGGGTGGTGCTGGAACAGGAGCTGGAGCTG
GAGCTGGAGGTCAAAGGTGAGCGGTCACAGCCAAAAGGGGGAGATGCAGA
CACACACGTGTGCAGTTTTCGGTAGCTAATGCGAGTCACGTCAACGCTGC
ATGCGAAATCGTTTTTTGAAAACTTTTTCCAGCTTGGCAACTTCAACTAC
GGATATCTGCGCTGTCTCAATTAGTGGCATTGGCCCTAAAAAAAAGGGAA
AAGTACTTGGTACTTCACATCTCTTCTTTTAGTTGCAAGCAAAATGTTAG
CACTCCACAAACAGTTTTTGACCAAAATTAGGGCATTAAGTGGATAGTTG
CTACATTAGTTATTTTAGCTATATTAAGAGCCCGAAAGTATTTCATTCCT
TTGCCAATATATTTCGAATCTTCTAAATGAATCTAAAAATCTCTATTTCC
TTGAACGCTGCTGTGTTTCAAAGCACTTGCAGCAGATTGGGGCAGCCACT
TAAAGTGGATCGGTGGTCAAACGAGGCGTATTGCCCTCCGGCTGACATAT
GTATTGGCGTCTATAATACGACAGACAAAAGCACAATCAGCTAAGCACTT
CTTCTTGGAAAAGCGGAAAAGTGGGATGAAAGGCTGATGGAGTACAAAAA
ATACGAAAAAAAAGGCAGGAAAATCGCTGCCTCTTGGCTGGTCATGTCAA
AGTGATTTTTCACCTCAAGGGCAAATTTAACACAATAATTTGCACAATTT
GTCAAAACAACCCTCCGGCTAAATGGTATCATAAACCACACACAAACACA
CACACGCACATACAATATATATACACACTATTGAGTCCTGTGAGTGCGAC
GGTGTGTGTTTGTGAGTGAGTTGATTGTCCTGCATGCATTTCTGCCATAT
AGTTCGCTTCTGTTACGCCCCACAAAATGTTTTCCGTTTTTCCTTTTCCC
GCTTTTCTCGCTTTTCCTGGGCTTCCCGGCTTTATTTTTTATGGCCTGCC
TTCCATGGAAAGGCCTTTCGATTATTATCAGGGTGTTTTGGCCACATTCA
TATGATTAGTCGGCTTTTAGATTTAAACTGACCTGATTTGGTAAAAGCAT
TTTTTGGCTGTATCATCGCTTCGAAGTTGAAAAAAATGGATTTAATTTAA
AGTGCGCTTCACTATAAGAGACTCCATTTTATATTAATCAATTTGAGTAA
TTTTAAGCTTAGTAAATGCGATTTTTTAAGATTCAAGTTTGTTTCATTTT
AAATGTACCGCTAAATATTAAATATTTTTCTTAAGGATTTTAGTTCTAGT
GAACTTTTTTTTGGCATTAATAATTTGCCATTTATAATATCAATCATTTA
CTAGAGAAGCTTACTTCTTTGTATAAATTTTAACTCTTACAGTCAATATT
TTCACACTGCAAAGAGTATTGCGGGTTCGTTTTTTTGTTGTGAATACAGT
TTAAAATATTTTCATATTTATGACTGGCAGTGTTTTGTCGCCAATGTCCC
GCTTTTCACACCCCTTTTTTATTCGCTTCACTCGTTTTTCAGTTTTGCAC
TTTGCAGTTTATGCAATTTCAGTTGCTGCCACTGTTGTTGTTTCTCTTCT
TGTTGTTGTCTGACCGCACTGCCACTGTTGTTGTTGTTTGGGTTTCGCTT
ATTTTTATTTGCACTTGTTTATGCTGCAATTTTTATAACAAACGCCAGAG
TGTCCTGTTTTGTTCCCCGACCACCTGACAACCAACCTCGTAGCCCGATT
CCAAAATAATAAAAAAAAAATAAAAGAATTAAGATCCCTGTTCCAAAAAC
CGATCTGTCTGCGGTTTTTATTACTAATGCGCTGTTCAATGTGTAAAAAC
ATTATGAATATAAAATTTAAATATAAATATATATTGTACCCATCAATTGC
AAAAGGCTGCAGTGCAAAACGACAATATAAATTCGTTGGCCACTGCAGAA
AATGTGTGCAAAATGCATGGAATTAAGCCAGCTTGATGAACTCGGTCTGT
AGTCGGTTTTATTATTTAAGGCGGCTTTTATTTTTTTCTTTTTTTTTGGC
ATTTCAATTGGAAATGGTTATAAATGTGCAAAATTATTTAAAGTTGTTGA
GATATTTGTGTTCATCTATTAGTACCTTTTTTTCCACATACTAAAACACT
TTGTGCAAGAATTAAGCTTTAAACGATCTGCGGAAAACAAGCTATAGCTG
AGTAAAAAACTAGTTCAGAACATTAGATGAGGACCAATGGAAACTCGCTT
TTGTTCTGAGCTTGAGGCTTAGCTAATTGAGTGTTAATTTCTCACGGTCT
CACCCGAAACTGTATTCAACACATTTTTGTGTAAATATATTTATGCTTTC
GCCGTTTTTTGTGTTTGCAACGAAATGCATTAACCCAGCTGAAGTTGTCC
GAGAACATCCTGCCACACATGTCCTTATGTCGTTGTGTCTGAACGCCCCT
TTGTCCATTTGTCCAGACCTTGGCAATGTTTTTACCGCCTGCCCTTTGTG
CCAGGACTTTCGTCCTTTCACTGCTACTGCCACTGCACCATGCGCCACTC
TCTGTTTGTGGCAAGTGTCGGTGCGTTTCTGTTCGTCTAGCAGTAAGTGT
ATCTGTATCTGTAAATGTATCTGCATCTGTGTGCGGCACTGCCAAAATCC
TTTTAAACTTGCCTCGCAAAACATTTTACATTCGATGACGTTTCCATTGC
AAGATGCAACGTCAACAATAAACCAGAAGCTGGCAAAATCAAATTTGTTG
GTCAACAGAAAAGAAATCGAGGCAGTGAGTTAAGGAGTGAGTGCAGTGGT
CTTCATTCCCCTGAATCTGGGATCCTGAATTCTGGACACTGAGTCCTGAG
TCCTTTTGTTGCGCATATTTCACTTACCGGAACTGCAAAGCAGAACGATT
GCTGAGCAAGCGATAAATCCTGCCGTGGAGCAGCAGAATGATGTGTGGTG
TCCTGGCGACGGCATTTCTATGTGACTGTATCTGTTTGTGGCTGGACTTT
AGATTGCGCTAGCTGAAACTGGAACTGGACTATTGCTCCTGGGAGTTCTG
GGGGGGTTTAGTTTTTGTGTGCCCCTCTTAAGCCTTCGGCTGGTGGGTTG
GATTGCGCACGAGTCTGCAGTTAGATCTCACGCTTGAGTCTTGTTTCGGT
CAGTTTCGGGCTCGCTTTCATCTTAATTTCCATCTTCATCGCTCCTGAAT
AGCCCGCCCACCGCCGCCCGCCGCCTTTTGCATATATGCAAATTTTAATT
TCCGTTACTTTCTCCGATATGCACACAACTTGCTGGCTTCATTTCCGTCT
TCTGTTTTCTCGTTTTGCTATTTTTTTTTTTTTTGCCCGTCTCTTTTCAC
ACTGCACACTCGAAAAAAATTGTTATCGCTTTTCTTCTGCCTTGCCAATT
GAACGGTAAGAGCGTGCGTTTTTATGATTTTGGAAATTTTCAATTTTCGC
GCTTTTTCGAAACAACTGCAATCGAAGGGCCGACAGGACGCGTCCGTCTG
TCTCTGAATGCGAATTGAAACTGAACGGCGCCGTCAGTGGCATCAGCGCC
AAAGGATATGCAACGGGCTTCTCGGCAGGCGCGCAGCAGCAACAGCAGCA
GCAGCAACAGCAGCAGCAACGGCAGCACACTACCAACGGCGGCAATGCCG
AAAGGATGTTCGTGGCAGGACGAAAATGAACGAGCGGAGCCGAGCGGCAA
CGATTGCCTGCCTCACGAAGAGCTGCCATTTGAAATACTGGGACTGAAAT
ACAACATAAACTTATAAAAAACGTTGGGAAATAGCGAAATAACGAGAACA
ATCCAACAGGAAAATGGGAATGCAGTGTAAAAGATTGCTTTCTAAAGATA
TTACATTTTTAATCTGATTGATTTGTCGTTAGGTATTAATTATATAGTAT
ATTATCAAAAGTAATAATCATTTAATATTGAAAACATATTTGTGCTTTAT
AGAATTAATTTTACACTCATTACTAATTACACTTTTATTATTCTCAATTG
AGAAACTTACATTTTTTGTAAGTTAAATTTGTTAATTTGTTCCCACAAGG
GCCAAAACTCTTATACGGCAAGACCATACTCTTCGAAAAGGCGAGCTCTT
CGGCCGACTTCGTGGCAGGACACGAGGTCCTTGCGTCGCTGCCGACGCCT
GCGCGACTTTGGGTCGACGAATCCCGCGGATCCGGCGAATTACAACGCTT
GCCAGCCACGTGCAAGTCTCATCATTGTTGTTGTTATTGTTATTGCTGTT
ATGCGATTGTCCTGGGTTATGGTTTCGTCCTTTTTTTTCCCCAATTCCCA
CCCCCCCCCCCCTTTGGCAGTCCTTGCTGCTGGCAATCAGCGAAACGTTA
CGTGCGTTGCCTGCTTTTTGTGTTTTTGTCCTGTTCCACAGGACGAGTTT
CTTATCAGTGGAGCAAGGAGAAAGAAGATGAGGCCGGCAGCGAGGAGCAA
GGAGCCTCCGACGACGAGGAGTCCTCGGATTTCGTCGGGAGCCGTGGCTG
GGTTCTGGTTTCTGCTTGGCAGCCGGCGTTGATATAAATTCTTATTGGCG
CATTACAAATTGCCGTCTTGCCTGAAGATGTGTGCTTGTGTGGGATGGTC
CTTGCACATAATGTAATCGCCTTACATAACACAAGGCATAAACAGTTTTT
CTTACTTGATTCGCGACAGACAACGGATTTGGTCCTTTGTTTTGCGGTAA
TTAGATTTCCACCTCATTTGCATACAAATGAGAACGAATCCATGAATGGC
GAATCAGTCTCTCAACAAACACGCATAAATTAGCTGAATAAAATATATGA
ACACAAATATATATATACAATATATATATATATTTAATGAGGCCTTTGTG
GTATTAAATGCTTAGCGATAACATATTAATGCCGCTAAGTCAGGCTTTAC
ACAGTTTTCATTTTACCCGTAAAGTTAACATTTTCCATTCGCTACGCACC
CGCATCGGCTTCAAGTTTTCGTCGTCTAATCCATAAAATCGCTTTCGCCA
CTAATTCAATTCAAATGTTTCGCTGCATTATTAAAAGCATTTCAATCACA
GTCAGTCAGCAATCGGCGGCTGTGTGAAAGTCGGAAAATCGCGAAAACGG
CAGGCAGCTGCCGACGGTCTTAACCCCACAAATCACCACCCATTCCCCCC
CCCCCCCCTCCTCACGACCCTCCTCCACTGGAAGCCAATCACTTGACATT
GCAATTGAATGCGAGGGCAGACCAACAAAAGCAAAGCCACCAACTAGCAA
TAACAATGCGAAAAACAACATTATATTCCAACCCGATGAAACGGCAAGCC
TGAGATTTTTTTTAAATATTTACATGGTTATAAAATACTTTTAATAAATT
ATTAATTGCAAATGAAATATTTTTACTAGTCAAAAAAGTTGCCTTAACTA
TTCAAGTGAGGAAAAGGTTTTATATTATATATATATTCTTTATATTTTTT
TATATTTCTAAGATCAAATAGATTAATTACAGATATAAGATATTAAGACT
GACTTGCAAGTAGGCGATTGAAAATATTTTTTTGGAGAGAAATCATTGTA
TATCCGATGTTAATGCTCATGTAATTGGCAGGCATTCGGAATTGATTAAG
GCCAGCTACGAAAAGTATGCAGCGCATTTTGCTGCTCGCACTCACACATA
GACGCTGACAGCTACACGCACACAAGGACATGAACGCACACATTCGCATT
CGCATTCACACTTGCACTTGCACATTGCAATTGCAGGCAATGCAATTGAA
TTCGTGGCAGTTTTAATGTAATTAGTTTTTACACCTTGCCAAACCGAATG
AGAGACAGCAGGCACTGCGAATTGAATGTGTGGACGGGGAATGGGGGGGA
GGTGGTGCTAAGGGGTCACGGTGGCGGGGGAGGGGGCGATGGGGTGGCAG
AGTGGGTGTTTGGCGCAGACACTGCGCATTTTCTAATTAAAAACGCCAAC
GGCAATTGCAGCATCGCAATTGCCATGGCATTTCCGTGTCTCTCGGCCTT
CCACCCACTCACCTCTCCACCCATTTTCCACCTCAATTTCCATCGCCCCC
GACGACAGGAAACGGCGGCTAATTGGCAACAAGACAAATCGCTGTGGCAA
TTTGCTGAGAATTATGCGACAAGATCAATTTGGCCGTCGAATTGGATGCG
AATCCAAGTGCGAGTGCGGCAGGTTCAAGGTCTGCAATTGTTGTAAATTT
CCATCGAGCGAAGAAGAAAACTGAACCAACAAAAAATTGTAAGATGTGCC
TTGGTCGGGAAAAAAAGTCATAAAACTTTTACGGCATTTTCGGTTCACGC
CTTTGGCGAGTGGGGTGTGATTTGAAATTAATATAACTAAAAGGTTTTAC
GGCGCCGCATTCTATCCGCGTTCTATCATGAGTTTCCCATTTTCCTGTCT
CTCTATTTCTTATTTTTGTTTTCCTTTTTTTTTTTATTGATTTTCACTCA
GCGCTGCTTGGTTATTTCCCCGATATATATGTATATAGTATAGTTTTTCT
TTTCGCGGAAAACCCTCTCTTTTCCATTTTTCCGCCGTTCTCCCGTTCCG
GTCCGCCGGAGTATCCGTTCCATTCTGTTCCGTTTCATTTGCCGGCGGTG
CGTTTAGTTGGTTATTCCTTTGACGCTGACGCTTCAAGCGGAAGTACAGA
TACGCTGGTGTGGGTATTGCCAAACAAAAACACACACCCTTTCTGACGGA
CAAAGCCTGCCTTAACCCTTGGGCCTTCTGACGGACCAATGCAGTTGGAA
AGTGGACATTGACGCACTCGAACAGACCACTAATTAAATTGGCGCTTCAA
CTCCAGGCGCTGGATATTCATTTTGGTTGATAGACCCTAAGGGATACAAA
TGGCATACTGGTAACATTATTACCTAGCATTCCAAACAGAGATTTACAGA
AAATTCGCTAAAAGCTTAATTATAGTGTCATTAAATATTCAATTCATGAC
TTAGACAGCCAGTAGATTGATTACAAATAACTTTAACAGAGACATCCTTA
AGTAATCCTTGTGAAAGTCTAATGTCAACCCTTAAAATTCTACCGCAAAA
CATATGGGCTAGGAAGCGATGTTCTTTCAACTAGCATATCATTCATATTT
TATACCAAACTTTCAAAATGTAATTTATTTATTTATTTGTGCATTCTTCG
GCGAACATACAAATATTTTCCATAGAAGAAAACGTAGTCGAGACTGAACT
TTTGCGCTATCAAGTTGCCCAGGCACTTGGAGAGTCCTGCCCACCTGCTG
TTTCCTTTTAATTCGGTTTACAGAAATATTTCCGTTTTAGTTTAAAGCGC
CATATCCGTGCTCCTTTTTCCCCAAGTGCAACACAATCCGGTCCCTTGTG
CTTGTGTATGGCCTTCAGGTGTAAACATTATCTGCATTTTCACGCTCCAA
ACAGAAATTTATTGCCGATGCTGGGATGCTCGAAAGGGCGGTGGAATATT
TGTACTAAAGGAAAATGGGTTGGAAAACCAGCCACATCCTATCTTTGCGG
TCTGGGCAATCGAAGAGCAACTTTATCGCTGCAATTCCGTCTCATCTTCC
AGCACTTGACTGTTGCTCTGCGTAAGTGTGTGTGCATTACGCTAAATTAC
ATTTTGAATATTGAATTGACGGTGCAGCTAACCTGACCTTACCTGTCAAC
CATCCCCCATGTACCAGCCCCTTGTGCCCCATCTTTCTAGAAAATCGAAT
TCGTTTGTTGCATTCCTTCAATTGAATTTTTGCGGTTACCCGGCGTCGCC
GTTTTCCCGACTTTCTAGGTGTCGACTTTCCGCTTTCACATCTTTTGGTT
CTCCTTGGGTGTCTTCTTTATCTAATTTGACGGTGACGCAAACAAATTCG
CTGCACAACCTGGCAATTTTCCGAGTTTGTCGAGGTTTCCACGGCATCGC
T